ID: 1062075871

View in Genome Browser
Species Human (GRCh38)
Location 9:134589759-134589781
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062075869_1062075871 -2 Left 1062075869 9:134589738-134589760 CCTGCATTGCTCTTTCTGCCTGC No data
Right 1062075871 9:134589759-134589781 GCCCCTCACCTGTGTACTCCTGG No data
1062075868_1062075871 5 Left 1062075868 9:134589731-134589753 CCTGATACCTGCATTGCTCTTTC No data
Right 1062075871 9:134589759-134589781 GCCCCTCACCTGTGTACTCCTGG No data
1062075867_1062075871 11 Left 1062075867 9:134589725-134589747 CCTCATCCTGATACCTGCATTGC No data
Right 1062075871 9:134589759-134589781 GCCCCTCACCTGTGTACTCCTGG No data
1062075866_1062075871 15 Left 1062075866 9:134589721-134589743 CCAGCCTCATCCTGATACCTGCA No data
Right 1062075871 9:134589759-134589781 GCCCCTCACCTGTGTACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062075871 Original CRISPR GCCCCTCACCTGTGTACTCC TGG Intergenic