ID: 1062075872

View in Genome Browser
Species Human (GRCh38)
Location 9:134589760-134589782
Sequence CCCAGGAGTACACAGGTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062075872_1062075883 -9 Left 1062075872 9:134589760-134589782 CCCCTCACCTGTGTACTCCTGGG No data
Right 1062075883 9:134589774-134589796 ACTCCTGGGGGTCCAGGGTGGGG No data
1062075872_1062075884 -8 Left 1062075872 9:134589760-134589782 CCCCTCACCTGTGTACTCCTGGG No data
Right 1062075884 9:134589775-134589797 CTCCTGGGGGTCCAGGGTGGGGG No data
1062075872_1062075882 -10 Left 1062075872 9:134589760-134589782 CCCCTCACCTGTGTACTCCTGGG No data
Right 1062075882 9:134589773-134589795 TACTCCTGGGGGTCCAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062075872 Original CRISPR CCCAGGAGTACACAGGTGAG GGG (reversed) Intergenic