ID: 1062075876 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:134589762-134589784 |
Sequence | CCCCCAGGAGTACACAGGTG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1062075876_1062075884 | -10 | Left | 1062075876 | 9:134589762-134589784 | CCTCACCTGTGTACTCCTGGGGG | No data | ||
Right | 1062075884 | 9:134589775-134589797 | CTCCTGGGGGTCCAGGGTGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1062075876 | Original CRISPR | CCCCCAGGAGTACACAGGTG AGG (reversed) | Intergenic | ||