ID: 1062075880

View in Genome Browser
Species Human (GRCh38)
Location 9:134589769-134589791
Sequence TGTGTACTCCTGGGGGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062075867_1062075880 21 Left 1062075867 9:134589725-134589747 CCTCATCCTGATACCTGCATTGC No data
Right 1062075880 9:134589769-134589791 TGTGTACTCCTGGGGGTCCAGGG No data
1062075869_1062075880 8 Left 1062075869 9:134589738-134589760 CCTGCATTGCTCTTTCTGCCTGC No data
Right 1062075880 9:134589769-134589791 TGTGTACTCCTGGGGGTCCAGGG No data
1062075866_1062075880 25 Left 1062075866 9:134589721-134589743 CCAGCCTCATCCTGATACCTGCA No data
Right 1062075880 9:134589769-134589791 TGTGTACTCCTGGGGGTCCAGGG No data
1062075870_1062075880 -10 Left 1062075870 9:134589756-134589778 CCTGCCCCTCACCTGTGTACTCC No data
Right 1062075880 9:134589769-134589791 TGTGTACTCCTGGGGGTCCAGGG No data
1062075868_1062075880 15 Left 1062075868 9:134589731-134589753 CCTGATACCTGCATTGCTCTTTC No data
Right 1062075880 9:134589769-134589791 TGTGTACTCCTGGGGGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062075880 Original CRISPR TGTGTACTCCTGGGGGTCCA GGG Intergenic