ID: 1062077455

View in Genome Browser
Species Human (GRCh38)
Location 9:134598637-134598659
Sequence CATGGGCTGTGATCCACCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062077455_1062077469 26 Left 1062077455 9:134598637-134598659 CCCTCGGTGGATCACAGCCCATG No data
Right 1062077469 9:134598686-134598708 GCCCACCGGGCAGGCACTTGAGG No data
1062077455_1062077467 17 Left 1062077455 9:134598637-134598659 CCCTCGGTGGATCACAGCCCATG No data
Right 1062077467 9:134598677-134598699 ACCGTGTGTGCCCACCGGGCAGG No data
1062077455_1062077463 12 Left 1062077455 9:134598637-134598659 CCCTCGGTGGATCACAGCCCATG No data
Right 1062077463 9:134598672-134598694 GACCCACCGTGTGTGCCCACCGG No data
1062077455_1062077464 13 Left 1062077455 9:134598637-134598659 CCCTCGGTGGATCACAGCCCATG No data
Right 1062077464 9:134598673-134598695 ACCCACCGTGTGTGCCCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062077455 Original CRISPR CATGGGCTGTGATCCACCGA GGG (reversed) Intergenic
No off target data available for this crispr