ID: 1062080001

View in Genome Browser
Species Human (GRCh38)
Location 9:134618799-134618821
Sequence CCAAGATTGCTGCCTCCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062080001_1062080007 3 Left 1062080001 9:134618799-134618821 CCGTGAGGAGGCAGCAATCTTGG No data
Right 1062080007 9:134618825-134618847 AGCGAGGCCGAGTGAGAGGCTGG No data
1062080001_1062080006 -1 Left 1062080001 9:134618799-134618821 CCGTGAGGAGGCAGCAATCTTGG No data
Right 1062080006 9:134618821-134618843 GGGCAGCGAGGCCGAGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062080001 Original CRISPR CCAAGATTGCTGCCTCCTCA CGG (reversed) Intergenic