ID: 1062080006

View in Genome Browser
Species Human (GRCh38)
Location 9:134618821-134618843
Sequence GGGCAGCGAGGCCGAGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062080001_1062080006 -1 Left 1062080001 9:134618799-134618821 CCGTGAGGAGGCAGCAATCTTGG No data
Right 1062080006 9:134618821-134618843 GGGCAGCGAGGCCGAGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062080006 Original CRISPR GGGCAGCGAGGCCGAGTGAG AGG Intergenic
No off target data available for this crispr