ID: 1062082033

View in Genome Browser
Species Human (GRCh38)
Location 9:134629394-134629416
Sequence CCGCCTCTGTGCCCCTCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062082025_1062082033 14 Left 1062082025 9:134629357-134629379 CCTCATGGCTGCCTCGGCTGATG No data
Right 1062082033 9:134629394-134629416 CCGCCTCTGTGCCCCTCGGGTGG No data
1062082029_1062082033 -9 Left 1062082029 9:134629380-134629402 CCGACGTGGGTTAGCCGCCTCTG No data
Right 1062082033 9:134629394-134629416 CCGCCTCTGTGCCCCTCGGGTGG No data
1062082028_1062082033 3 Left 1062082028 9:134629368-134629390 CCTCGGCTGATGCCGACGTGGGT No data
Right 1062082033 9:134629394-134629416 CCGCCTCTGTGCCCCTCGGGTGG No data
1062082023_1062082033 27 Left 1062082023 9:134629344-134629366 CCAGAAATTCGTGCCTCATGGCT No data
Right 1062082033 9:134629394-134629416 CCGCCTCTGTGCCCCTCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062082033 Original CRISPR CCGCCTCTGTGCCCCTCGGG TGG Intergenic
No off target data available for this crispr