ID: 1062082109

View in Genome Browser
Species Human (GRCh38)
Location 9:134629685-134629707
Sequence GACCTGCTCCCTGTCTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062082106_1062082109 -6 Left 1062082106 9:134629668-134629690 CCCTGGCTCATGGGTGTGACCTG No data
Right 1062082109 9:134629685-134629707 GACCTGCTCCCTGTCTGGACTGG No data
1062082107_1062082109 -7 Left 1062082107 9:134629669-134629691 CCTGGCTCATGGGTGTGACCTGC No data
Right 1062082109 9:134629685-134629707 GACCTGCTCCCTGTCTGGACTGG No data
1062082098_1062082109 19 Left 1062082098 9:134629643-134629665 CCCAGCCCTGTGCCTGGCAGGAA No data
Right 1062082109 9:134629685-134629707 GACCTGCTCCCTGTCTGGACTGG No data
1062082100_1062082109 14 Left 1062082100 9:134629648-134629670 CCCTGTGCCTGGCAGGAAAACCC No data
Right 1062082109 9:134629685-134629707 GACCTGCTCCCTGTCTGGACTGG No data
1062082095_1062082109 30 Left 1062082095 9:134629632-134629654 CCATGAGAATTCCCAGCCCTGTG No data
Right 1062082109 9:134629685-134629707 GACCTGCTCCCTGTCTGGACTGG No data
1062082099_1062082109 18 Left 1062082099 9:134629644-134629666 CCAGCCCTGTGCCTGGCAGGAAA No data
Right 1062082109 9:134629685-134629707 GACCTGCTCCCTGTCTGGACTGG No data
1062082101_1062082109 13 Left 1062082101 9:134629649-134629671 CCTGTGCCTGGCAGGAAAACCCT No data
Right 1062082109 9:134629685-134629707 GACCTGCTCCCTGTCTGGACTGG No data
1062082103_1062082109 7 Left 1062082103 9:134629655-134629677 CCTGGCAGGAAAACCCTGGCTCA No data
Right 1062082109 9:134629685-134629707 GACCTGCTCCCTGTCTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062082109 Original CRISPR GACCTGCTCCCTGTCTGGAC TGG Intergenic
No off target data available for this crispr