ID: 1062083376

View in Genome Browser
Species Human (GRCh38)
Location 9:134636181-134636203
Sequence CAGGCTGCAGGCTTGGACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062083363_1062083376 9 Left 1062083363 9:134636149-134636171 CCACCCCCTCTCACCCACATCTA No data
Right 1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG No data
1062083360_1062083376 14 Left 1062083360 9:134636144-134636166 CCCTCCCACCCCCTCTCACCCAC No data
Right 1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG No data
1062083356_1062083376 26 Left 1062083356 9:134636132-134636154 CCCTCTCTCACCCCCTCCCACCC No data
Right 1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG No data
1062083362_1062083376 10 Left 1062083362 9:134636148-134636170 CCCACCCCCTCTCACCCACATCT No data
Right 1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG No data
1062083364_1062083376 6 Left 1062083364 9:134636152-134636174 CCCCCTCTCACCCACATCTAGAT No data
Right 1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG No data
1062083371_1062083376 -5 Left 1062083371 9:134636163-134636185 CCACATCTAGATGGAGCACAGGC No data
Right 1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG No data
1062083369_1062083376 -4 Left 1062083369 9:134636162-134636184 CCCACATCTAGATGGAGCACAGG No data
Right 1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG No data
1062083357_1062083376 25 Left 1062083357 9:134636133-134636155 CCTCTCTCACCCCCTCCCACCCC No data
Right 1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG No data
1062083368_1062083376 3 Left 1062083368 9:134636155-134636177 CCTCTCACCCACATCTAGATGGA No data
Right 1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG No data
1062083359_1062083376 15 Left 1062083359 9:134636143-134636165 CCCCTCCCACCCCCTCTCACCCA No data
Right 1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG No data
1062083365_1062083376 5 Left 1062083365 9:134636153-134636175 CCCCTCTCACCCACATCTAGATG No data
Right 1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG No data
1062083358_1062083376 16 Left 1062083358 9:134636142-134636164 CCCCCTCCCACCCCCTCTCACCC No data
Right 1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG No data
1062083366_1062083376 4 Left 1062083366 9:134636154-134636176 CCCTCTCACCCACATCTAGATGG No data
Right 1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG No data
1062083361_1062083376 13 Left 1062083361 9:134636145-134636167 CCTCCCACCCCCTCTCACCCACA No data
Right 1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062083376 Original CRISPR CAGGCTGCAGGCTTGGACTG GGG Intergenic
No off target data available for this crispr