ID: 1062084561 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:134642029-134642051 |
Sequence | CCCGTTCTTCTTTGTGGCGG CGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 120 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 10, 4: 108} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1062084561_1062084574 | 15 | Left | 1062084561 | 9:134642029-134642051 | CCGCCGCCACAAAGAAGAACGGG | 0: 1 1: 0 2: 1 3: 10 4: 108 |
||
Right | 1062084574 | 9:134642067-134642089 | CATGACCTCCTAAAGTGGTGCGG | 0: 1 1: 0 2: 15 3: 188 4: 2379 |
||||
1062084561_1062084570 | 10 | Left | 1062084561 | 9:134642029-134642051 | CCGCCGCCACAAAGAAGAACGGG | 0: 1 1: 0 2: 1 3: 10 4: 108 |
||
Right | 1062084570 | 9:134642062-134642084 | GTCCCCATGACCTCCTAAAGTGG | 0: 1 1: 0 2: 0 3: 5 4: 96 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1062084561 | Original CRISPR | CCCGTTCTTCTTTGTGGCGG CGG (reversed) | Exonic | ||