ID: 1062084574

View in Genome Browser
Species Human (GRCh38)
Location 9:134642067-134642089
Sequence CATGACCTCCTAAAGTGGTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2583
Summary {0: 1, 1: 0, 2: 15, 3: 188, 4: 2379}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062084559_1062084574 24 Left 1062084559 9:134642020-134642042 CCAGAACAGCCGCCGCCACAAAG 0: 1
1: 0
2: 1
3: 10
4: 106
Right 1062084574 9:134642067-134642089 CATGACCTCCTAAAGTGGTGCGG 0: 1
1: 0
2: 15
3: 188
4: 2379
1062084565_1062084574 12 Left 1062084565 9:134642032-134642054 CCGCCACAAAGAAGAACGGGGGG 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1062084574 9:134642067-134642089 CATGACCTCCTAAAGTGGTGCGG 0: 1
1: 0
2: 15
3: 188
4: 2379
1062084558_1062084574 28 Left 1062084558 9:134642016-134642038 CCTTCCAGAACAGCCGCCGCCAC 0: 1
1: 0
2: 3
3: 18
4: 147
Right 1062084574 9:134642067-134642089 CATGACCTCCTAAAGTGGTGCGG 0: 1
1: 0
2: 15
3: 188
4: 2379
1062084561_1062084574 15 Left 1062084561 9:134642029-134642051 CCGCCGCCACAAAGAAGAACGGG 0: 1
1: 0
2: 1
3: 10
4: 108
Right 1062084574 9:134642067-134642089 CATGACCTCCTAAAGTGGTGCGG 0: 1
1: 0
2: 15
3: 188
4: 2379
1062084567_1062084574 9 Left 1062084567 9:134642035-134642057 CCACAAAGAAGAACGGGGGGTGC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1062084574 9:134642067-134642089 CATGACCTCCTAAAGTGGTGCGG 0: 1
1: 0
2: 15
3: 188
4: 2379
1062084557_1062084574 29 Left 1062084557 9:134642015-134642037 CCCTTCCAGAACAGCCGCCGCCA 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1062084574 9:134642067-134642089 CATGACCTCCTAAAGTGGTGCGG 0: 1
1: 0
2: 15
3: 188
4: 2379
1062084556_1062084574 30 Left 1062084556 9:134642014-134642036 CCCCTTCCAGAACAGCCGCCGCC 0: 1
1: 0
2: 0
3: 21
4: 142
Right 1062084574 9:134642067-134642089 CATGACCTCCTAAAGTGGTGCGG 0: 1
1: 0
2: 15
3: 188
4: 2379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062084574 Original CRISPR CATGACCTCCTAAAGTGGTG CGG Exonic