ID: 1062084998

View in Genome Browser
Species Human (GRCh38)
Location 9:134643803-134643825
Sequence TTTTCCCCAGAAACTCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062084994_1062084998 0 Left 1062084994 9:134643780-134643802 CCTGTCTCAGCGCCTCTGGGGAC 0: 1
1: 0
2: 0
3: 19
4: 155
Right 1062084998 9:134643803-134643825 TTTTCCCCAGAAACTCAGGAGGG No data
1062084993_1062084998 1 Left 1062084993 9:134643779-134643801 CCCTGTCTCAGCGCCTCTGGGGA 0: 1
1: 0
2: 2
3: 9
4: 182
Right 1062084998 9:134643803-134643825 TTTTCCCCAGAAACTCAGGAGGG No data
1062084988_1062084998 20 Left 1062084988 9:134643760-134643782 CCATTGCCGGGGGACTAGGCCCT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1062084998 9:134643803-134643825 TTTTCCCCAGAAACTCAGGAGGG No data
1062084989_1062084998 14 Left 1062084989 9:134643766-134643788 CCGGGGGACTAGGCCCTGTCTCA 0: 1
1: 0
2: 2
3: 24
4: 200
Right 1062084998 9:134643803-134643825 TTTTCCCCAGAAACTCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062084998 Original CRISPR TTTTCCCCAGAAACTCAGGA GGG Intronic
No off target data available for this crispr