ID: 1062085997

View in Genome Browser
Species Human (GRCh38)
Location 9:134648832-134648854
Sequence GCTCAGGCTCAGAGCCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 309}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062085997_1062086006 12 Left 1062085997 9:134648832-134648854 CCTCTGAGGCTCTGAGCCTGAGC 0: 1
1: 0
2: 0
3: 32
4: 309
Right 1062086006 9:134648867-134648889 TCCTTGGGCAGTCGCGGGCCAGG No data
1062085997_1062086002 -3 Left 1062085997 9:134648832-134648854 CCTCTGAGGCTCTGAGCCTGAGC 0: 1
1: 0
2: 0
3: 32
4: 309
Right 1062086002 9:134648852-134648874 AGCCAGGAAGGTGCATCCTTGGG No data
1062085997_1062086001 -4 Left 1062085997 9:134648832-134648854 CCTCTGAGGCTCTGAGCCTGAGC 0: 1
1: 0
2: 0
3: 32
4: 309
Right 1062086001 9:134648851-134648873 GAGCCAGGAAGGTGCATCCTTGG No data
1062085997_1062086005 7 Left 1062085997 9:134648832-134648854 CCTCTGAGGCTCTGAGCCTGAGC 0: 1
1: 0
2: 0
3: 32
4: 309
Right 1062086005 9:134648862-134648884 GTGCATCCTTGGGCAGTCGCGGG No data
1062085997_1062086004 6 Left 1062085997 9:134648832-134648854 CCTCTGAGGCTCTGAGCCTGAGC 0: 1
1: 0
2: 0
3: 32
4: 309
Right 1062086004 9:134648861-134648883 GGTGCATCCTTGGGCAGTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062085997 Original CRISPR GCTCAGGCTCAGAGCCTCAG AGG (reversed) Intronic
900131817 1:1090476-1090498 GCTCACGCCCAGAGCAGCAGCGG + Intronic
900359872 1:2283331-2283353 GCAAGGACTCAGAGCCTCAGGGG + Intronic
901591917 1:10351524-10351546 CCTTAGGCTCAAAGCCTCACAGG + Intronic
902532628 1:17100059-17100081 ACTCAGGGGCAGCGCCTCAGAGG - Intronic
902627394 1:17684556-17684578 GCTCAGGCTAAGGGCTCCAGAGG - Intronic
903172803 1:21564146-21564168 GCCCTGGCTCAAGGCCTCAGGGG - Exonic
903809654 1:26028371-26028393 GTTCAGGCTCAGAGCCAAACAGG + Intronic
903815649 1:26062501-26062523 GCTCCTTCTCTGAGCCTCAGGGG - Intronic
904090951 1:27944870-27944892 GCTCAGGCTCTGAGCCACTTAGG - Intronic
904952939 1:34258963-34258985 GCTCAGACTCACATCCTAAGTGG + Intergenic
906208486 1:43999502-43999524 GCTCAGCCTCTGCGGCTCAGAGG - Intronic
906286620 1:44591986-44592008 GCCCAGGCTCAGAAGCTCACAGG - Intronic
906312217 1:44762088-44762110 CCTCAGGTTCAGAGTCACAGAGG - Intronic
907468264 1:54653924-54653946 GTCCAGGCTCAGAGTCTCATTGG - Exonic
908117278 1:60952556-60952578 GGCCAGGCTCAGTGCCCCAGAGG + Intronic
909026430 1:70487126-70487148 GCCCAGTCTCAGTGACTCAGAGG - Intergenic
909405227 1:75281586-75281608 TCACAGGCTCAGAACCTAAGAGG + Intronic
910679940 1:89852786-89852808 GCCCAGGTTCAGAGCCCCAAAGG + Intronic
911269201 1:95780080-95780102 TCTGAGGGTCAGAGACTCAGTGG + Intergenic
912492070 1:110067925-110067947 CATCCGGCTCAGGGCCTCAGCGG + Intronic
912528847 1:110305557-110305579 GCTCAGTCTCAGAGACCCACAGG + Intergenic
913289470 1:117258879-117258901 GCTCAGGCCCATTGCTTCAGAGG - Intergenic
916370072 1:164082047-164082069 GCTGAGGCAAAGAACCTCAGAGG - Intergenic
918410673 1:184255045-184255067 GCTCAGTCACAGAGCCTGAGGGG - Intergenic
919118758 1:193313610-193313632 ACTCAGGAACAGATCCTCAGAGG + Intergenic
920147341 1:203873209-203873231 GCTGAGACTGAGAGCCTCAAAGG - Intergenic
921955110 1:220974389-220974411 GTTCAGGCACAGAGACTCACTGG + Intergenic
922800194 1:228361580-228361602 GCTCAGGATCTCAGCATCAGGGG + Intronic
923982996 1:239346869-239346891 GATCAGGCAAAGAGCCTCAACGG + Intergenic
924591642 1:245409768-245409790 GGCCAGCCTCAGAGTCTCAGAGG + Intronic
1063411562 10:5840410-5840432 GCTCAGACTCACATCCCCAGGGG - Intronic
1064471386 10:15639494-15639516 ACTGAGTCTCAGAGCCTCAGTGG + Intronic
1065960180 10:30727729-30727751 ACTCAGCCTCAGGGCCTCACTGG + Intergenic
1066010227 10:31188057-31188079 GCTCTGGCTCAAAGGCTGAGGGG + Intergenic
1066440269 10:35431743-35431765 GCTCAGGCTTGGAGCCTCATAGG + Intronic
1068194726 10:53701288-53701310 CCTCAGGATAAGAGCCTTAGAGG - Intergenic
1068946403 10:62733843-62733865 GCTCAGCCTCAGAGCTTCTCAGG + Intergenic
1069589683 10:69634133-69634155 GCTGAGGCTCTGGGCCACAGAGG + Intergenic
1069608676 10:69757697-69757719 CCTGTGGCTCAGAGGCTCAGAGG + Intergenic
1069787268 10:70996897-70996919 GCTCTGACTCAGTGCCTCAGGGG - Intergenic
1069812491 10:71172633-71172655 GCTTGGGATCTGAGCCTCAGTGG - Intergenic
1070592105 10:77808684-77808706 GCTCAGGCCCTGGGCATCAGGGG - Intronic
1070593313 10:77815700-77815722 GCTGAGGCTCACAGCTACAGAGG + Intronic
1070639910 10:78160771-78160793 GCTCAGGCTCCGAGGCTCCATGG + Intergenic
1072435875 10:95414517-95414539 GGTCAGGCTCCGAGACTCTGCGG + Exonic
1074523217 10:114243408-114243430 GCTCAGGCTCAGAGTGTCAACGG - Intronic
1075139003 10:119814794-119814816 GCTCAGCCTGAGACCCACAGTGG - Intronic
1075618188 10:123906515-123906537 ACACATGCTCAGAACCTCAGAGG - Intronic
1076209574 10:128629598-128629620 GCTCTGACTCAGAGGCCCAGAGG + Intergenic
1076575589 10:131464655-131464677 ACTCAGGCTCAGTAGCTCAGAGG - Intergenic
1077435330 11:2536165-2536187 GCTCAGGCTCAGGGCAGCAGGGG + Intronic
1077463239 11:2721409-2721431 GCTCAGCCTCCCTGCCTCAGAGG + Intronic
1077474502 11:2779974-2779996 GCCCCGGCTCAGAGCCTGACAGG - Intronic
1078018188 11:7633164-7633186 GCCAAGGATTAGAGCCTCAGAGG + Intronic
1078191517 11:9095437-9095459 GCTCAGACTGAGGGCCTCAAAGG + Intronic
1080605399 11:33861013-33861035 ACTGAGGCTCAGAGAATCAGAGG - Intronic
1080647401 11:34197084-34197106 GCACACGTTCTGAGCCTCAGTGG + Intronic
1081567222 11:44267434-44267456 GCTCATTCTCAGAGCACCAGGGG + Intronic
1083135251 11:60667921-60667943 GCTTGGGCTCAGAGCTTCAAAGG + Intergenic
1083651454 11:64207026-64207048 GCTCACTCCCAGACCCTCAGGGG - Intronic
1083723636 11:64617290-64617312 ACACAGGCTCAGACCCACAGAGG - Intronic
1083923104 11:65790973-65790995 GCACAGGCCCAGTGCCTCTGTGG - Intronic
1085300747 11:75456895-75456917 GGTCAGGCCCAGAGCCGCAGTGG - Intronic
1086436955 11:86791125-86791147 GCACAGGCGCAGAGCTGCAGTGG + Intronic
1086595618 11:88567246-88567268 GGTCAGCCTCAGTGCCACAGTGG - Exonic
1087094199 11:94304817-94304839 CCTCAGCCTCATAGTCTCAGGGG + Intergenic
1087370104 11:97273500-97273522 GGACAGGCTCAGAGCCAGAGAGG + Intergenic
1088934781 11:114388847-114388869 GCTCACGCTCATAATCTCAGGGG - Intergenic
1089676255 11:120092006-120092028 TCTCCTGCTCAGAGCCTCTGGGG - Intergenic
1090437382 11:126697927-126697949 GCTCAGTCTCTGAGCCTCCCTGG - Intronic
1090647444 11:128777197-128777219 GTTCAGGCTCAGGGCCGCTGGGG + Intronic
1090648280 11:128784111-128784133 GCTCTGCTTCAGAGCCTCACTGG - Intronic
1092228363 12:6763738-6763760 GGTTAGCCTCAGAGCCTCTGGGG - Intronic
1094381198 12:29845030-29845052 GCTCAGGGTGAGAACCTCAAGGG + Intergenic
1094642088 12:32285685-32285707 GCTGAGTCTCAGCTCCTCAGGGG - Intronic
1095825339 12:46524984-46525006 CCTCTGGCACAGAGCCCCAGGGG + Intergenic
1097792481 12:63829550-63829572 GCTCAGCCACTGAGCCTAAGAGG - Intergenic
1098853350 12:75624069-75624091 TCTTAGGATCAGCGCCTCAGGGG - Intergenic
1100194121 12:92224776-92224798 GCTCTGTCTCAGTGACTCAGGGG + Intergenic
1101187421 12:102293628-102293650 GCTCACCCTAACAGCCTCAGTGG - Intergenic
1102783970 12:115588778-115588800 TGTCAGGCCCAGAGCCCCAGCGG - Intergenic
1103328374 12:120136861-120136883 TCTCAGGATCACAGCCTGAGAGG + Intronic
1104896691 12:132168328-132168350 ACTGAGGCTCAGGACCTCAGTGG - Intergenic
1106749248 13:32742048-32742070 GCTAAGGCTCAGATGCTAAGAGG - Intronic
1109024897 13:57144261-57144283 GGTCAGGACCAGAGCCTCTGTGG + Intronic
1109025884 13:57150831-57150853 GGTCAGGACCAGAGCCTCTGTGG + Intronic
1109026874 13:57157404-57157426 GGTCAGGACCAGAGCCTCTGTGG + Intergenic
1109027866 13:57163975-57163997 GGTCAGGACCAGAGCCTCTGTGG + Intergenic
1109028852 13:57170540-57170562 GGTCAGGACCAGAGCCTCTGTGG + Intergenic
1116779348 14:49218988-49219010 GCTCTGGCCCAGAGCCACTGAGG + Intergenic
1118736911 14:68707571-68707593 CCTCAGGCTCTGACACTCAGAGG + Intronic
1119403132 14:74378025-74378047 GCACCGGCACAGAGCCGCAGCGG + Intergenic
1119719045 14:76878906-76878928 GCTCAGGCCCCAAGCCTCGGGGG - Intergenic
1120229842 14:81829953-81829975 GCTCACGCTCAGCGCCTCCTCGG - Intergenic
1120852687 14:89185712-89185734 CCTCATCCTGAGAGCCTCAGGGG - Intronic
1121182792 14:91942221-91942243 GGCCAGGCTCAGGGCCTTAGGGG - Intronic
1121448418 14:93992860-93992882 GGCCAGGCTGAGGGCCTCAGAGG + Intergenic
1121656965 14:95604277-95604299 TCTCTGGCTCAGAGCCTCCCAGG - Intergenic
1122430101 14:101635061-101635083 GCTCGGTCTCAGAGGGTCAGTGG + Intergenic
1122722309 14:103729035-103729057 TCTCAGGCTCAGTGCCACCGAGG - Intronic
1122858538 14:104571784-104571806 ACTCAGGCCCAGCTCCTCAGAGG + Intronic
1122912186 14:104836296-104836318 GCGCCGGCACAGAGCCGCAGCGG + Intergenic
1123055748 14:105568845-105568867 GCTCAGGCCCCGACTCTCAGGGG + Intergenic
1123080105 14:105688364-105688386 GCTCAGGCCCCGACTCTCAGGGG + Intergenic
1123080153 14:105688618-105688640 GCTCAGGCCCCGACTCTCAGGGG + Intergenic
1123947388 15:25245372-25245394 GCTGAAGCTCAGACCCTCCGTGG + Intergenic
1124044454 15:26135653-26135675 GCTCATTGCCAGAGCCTCAGGGG - Intergenic
1124244961 15:28060919-28060941 GACCAGGCTCAGAGCTCCAGAGG + Intronic
1124635858 15:31364943-31364965 ACTCAGGCATACAGCCTCAGGGG - Intronic
1124663440 15:31569992-31570014 GCCTAGGCTCAGTCCCTCAGCGG + Intronic
1126242117 15:46456792-46456814 GCAAAGCCTCAGACCCTCAGTGG - Intergenic
1126825765 15:52546319-52546341 GCACAGGCTCACAGCCTCCTGGG - Intergenic
1128452407 15:67813355-67813377 GCTATGGCTCAGAGGCTCAGAGG - Intergenic
1128537123 15:68500031-68500053 TCTCTGGCCCAGAACCTCAGGGG + Intergenic
1129171734 15:73812170-73812192 TGTCAGGCTTAGAGCTTCAGGGG - Intergenic
1129231063 15:74197466-74197488 CCTCAAACTCAGACCCTCAGGGG - Intronic
1130194519 15:81766797-81766819 GCACATGCTCATAGCCACAGTGG + Intergenic
1132555480 16:570142-570164 GCCCAGGCCCGGAGCCGCAGGGG - Intronic
1132659631 16:1055578-1055600 GCTCGGGCTCAGCGCTTCTGGGG + Intergenic
1132719087 16:1307236-1307258 TCCCAGGCTCAGAGCCTCCGTGG - Intergenic
1132855107 16:2041209-2041231 ACTGAGGCTCAGAGCCCCAGGGG - Intronic
1133013900 16:2930122-2930144 GCTCAGGATCAGAGACCAAGAGG - Intronic
1133236164 16:4388386-4388408 GCCGGGTCTCAGAGCCTCAGGGG - Intronic
1133340491 16:5032760-5032782 ACAAAGGCTCAGAGGCTCAGGGG - Intronic
1134303174 16:13009405-13009427 GCTCAGGATCATAACCTCGGAGG + Intronic
1136546848 16:30959303-30959325 ACTGAGTCTCACAGCCTCAGAGG - Intronic
1138352328 16:56352585-56352607 GCTCAGTCTCAGGGCCACACGGG + Intronic
1138375061 16:56557606-56557628 GTGCATGCTCAGAGCCCCAGGGG - Intergenic
1138539283 16:57678821-57678843 ACTCACGCTAAGACCCTCAGGGG + Intronic
1139291962 16:65867554-65867576 TCTCTAGCTAAGAGCCTCAGGGG - Intergenic
1139477670 16:67210800-67210822 GCCCAGGATCAGGGCCACAGAGG + Exonic
1139579853 16:67866148-67866170 GCACAGTCTCAGAGCCTGATTGG + Intronic
1140481333 16:75264423-75264445 TCTCTGGCCCAGGGCCTCAGGGG - Exonic
1141702938 16:85650727-85650749 GCTCGGGCACAGAGGCTCAGCGG + Intronic
1141932848 16:87217273-87217295 GCTCGGGCCCTGGGCCTCAGTGG + Intronic
1141991263 16:87611728-87611750 TCCCAGGCCCAGAGACTCAGGGG - Intronic
1142271058 16:89089433-89089455 GTTCAGGATCCGATCCTCAGAGG - Intronic
1142723465 17:1793730-1793752 GATAAGCCTCAGAGCCTCTGGGG - Intronic
1143136216 17:4714107-4714129 CCTCAGACTGTGAGCCTCAGAGG - Intronic
1143530884 17:7502732-7502754 ACTCAGGCCCTGAGCCCCAGGGG - Intronic
1144760332 17:17703528-17703550 GCTCCGGCTCTGGGGCTCAGGGG + Intronic
1145013602 17:19383225-19383247 GCACAGGCTGGGGGCCTCAGGGG - Exonic
1145118697 17:20236116-20236138 GCTCAGTATCAGAGCATCTGTGG - Intronic
1145791527 17:27630778-27630800 GCTGAGGCTCAGAGTCTAAGGGG - Exonic
1145921745 17:28614851-28614873 GATCAGGCTCAGGGCCAGAGAGG - Exonic
1146462572 17:33057766-33057788 GCTATGGCTGAGATCCTCAGTGG + Intronic
1146525531 17:33564085-33564107 GCTCAGCCTCACCTCCTCAGGGG - Intronic
1146555235 17:33817348-33817370 ACTCAGGCTCAGAGAGTCTGAGG - Intronic
1146679442 17:34796440-34796462 GCTCAGGGGCCCAGCCTCAGAGG - Intergenic
1146956564 17:36939521-36939543 GCTGAGCCTCTGAGCCTCCGCGG + Intronic
1147648803 17:42050460-42050482 GCGGAGGCTCAGTGCCTCTGCGG - Intronic
1147681514 17:42250596-42250618 GCTCAGGCTGTGAACCACAGTGG + Intronic
1148330273 17:46809910-46809932 CCTCAAGCTCAGAGGCTCAGGGG + Intronic
1150230155 17:63545344-63545366 CATCAGGCCCAGAGCCTCTGTGG + Intronic
1150251022 17:63704502-63704524 GCTCATGGTCAGCTCCTCAGCGG + Exonic
1150894889 17:69198055-69198077 ACTCAAGCTAAGAGCCTGAGAGG + Intronic
1151475089 17:74340691-74340713 GCTCAGGCTCAAAGCTGCAAAGG + Intronic
1151728602 17:75898219-75898241 GCACTGGCTCTGTGCCTCAGGGG - Intergenic
1152008231 17:77695594-77695616 GTTCTCCCTCAGAGCCTCAGTGG - Intergenic
1152564884 17:81095922-81095944 GCTCATGCTCAGTTCCCCAGGGG - Intronic
1152805884 17:82356088-82356110 GCTGAGGCTCAGAGCCTCCTGGG - Intergenic
1152815685 17:82406283-82406305 GTGCAGCCTCAGGGCCTCAGTGG - Intronic
1152899838 17:82934145-82934167 GCTCAGGTTCTGAGCACCAGAGG - Intronic
1153710800 18:7796814-7796836 GCTCAGGCTCAGTGCACCACTGG - Intronic
1156213322 18:34971028-34971050 TCTCAGCCTCAGAGACTGAGGGG + Intergenic
1156253450 18:35374074-35374096 GAGCCGGCTCAGAGCCTCATGGG + Exonic
1157806945 18:50665337-50665359 GCTCATGCTGAGGGGCTCAGAGG - Intronic
1158181105 18:54715730-54715752 GCTGAGGCTCAGGGCTTCTGAGG - Intergenic
1158581930 18:58691365-58691387 GCTCAGGCCCAGCTCCTCTGTGG + Intronic
1158690087 18:59652626-59652648 GCTCAGACTCAGAGCCAAATGGG + Intronic
1159086851 18:63802286-63802308 GATCAGGCTCTGAGATTCAGTGG - Intronic
1160017240 18:75154280-75154302 GGGCAAGCACAGAGCCTCAGGGG + Intergenic
1160222657 18:76988663-76988685 CCGCAGGCTCAGGGCCACAGCGG + Intronic
1160675312 19:387943-387965 GCTGAGACTCAGAGCCCCTGTGG - Intergenic
1160789816 19:918229-918251 ACTGAGGCTCAGAGGGTCAGGGG + Intronic
1160920087 19:1515477-1515499 GCTGAGGCTCAGAGGCTCCTGGG + Intergenic
1161480057 19:4505910-4505932 GCTCAGGTTACAAGCCTCAGGGG + Intronic
1162124969 19:8494483-8494505 GCTCTCGCTGACAGCCTCAGAGG - Intronic
1162996462 19:14338961-14338983 ACCCATGCCCAGAGCCTCAGAGG + Intergenic
1163527760 19:17831519-17831541 GCTCAGGATCAGAACTTCAGTGG - Intronic
1164555701 19:29249225-29249247 GCCCAGACTCACAGCCTCACTGG + Intergenic
1164580031 19:29429288-29429310 GCCCAGGGGCTGAGCCTCAGTGG + Intergenic
1164747100 19:30624389-30624411 GCTCGGGCTCAGATTCCCAGGGG - Intronic
1165385024 19:35505302-35505324 GCACTGGCCGAGAGCCTCAGGGG - Intronic
1165822287 19:38684276-38684298 GTTCAGGCTCAGCCCCTTAGTGG + Intronic
1166015196 19:39974340-39974362 GCTCAAGCCCAACGCCTCAGTGG + Exonic
1166046890 19:40235163-40235185 GCTCAGGCTCAGGGACCCTGAGG + Intronic
1167773874 19:51542384-51542406 GCAAAGTCTCAGAGCCACAGAGG + Intergenic
1168095110 19:54110010-54110032 GCTGAGGCTCACAGGCCCAGAGG + Intronic
1168169539 19:54576417-54576439 CCTCAGAATCAGAGCCTCTGGGG + Intronic
1168172370 19:54597102-54597124 CCTCAGAATCAGAGCCTCTGGGG + Intronic
925049045 2:796798-796820 ACCCAGGTTCACAGCCTCAGGGG - Intergenic
925277937 2:2663601-2663623 GCTGAGGGGCAGAGGCTCAGAGG - Intergenic
926161128 2:10490326-10490348 GTTCTGGCTCTGAGCCTCTGGGG + Intergenic
927142979 2:20142224-20142246 TTTCAGCCCCAGAGCCTCAGAGG - Intergenic
928238957 2:29569932-29569954 GCCCAGGCTCAGAGCTCCAGAGG + Intronic
929432255 2:41897207-41897229 GCTCAGGCTCAGAGGCAACGTGG - Intergenic
932618680 2:73252746-73252768 GATCAGGCACGCAGCCTCAGAGG - Exonic
932819995 2:74891382-74891404 AATCAGGCTCACATCCTCAGTGG - Exonic
937368371 2:121281293-121281315 GGTCAGGAGCAGAGCCCCAGGGG + Intronic
937727930 2:125188952-125188974 GCTCAGGCTCATAGACTCTGAGG + Intergenic
941810056 2:169746565-169746587 GCACAGTCCCAGAGCCTCAGTGG + Intronic
942060108 2:172221450-172221472 GCTTTGGCTCAGAGCCTGAGTGG - Intergenic
945041476 2:205746634-205746656 GCTCAGTCCCTGAGCCCCAGTGG - Intronic
945048219 2:205800289-205800311 GCTCAGGTTCAGAGCTTCCATGG - Intergenic
945435228 2:209810103-209810125 GCTCAGGCCCAGAGCATCTTAGG - Intronic
947544675 2:231002476-231002498 GCTCACCCTCCGATCCTCAGGGG + Intronic
948386235 2:237582599-237582621 GGCCAGGAGCAGAGCCTCAGAGG - Intronic
948491328 2:238315089-238315111 GTTCAGGGTCCGAACCTCAGGGG + Intergenic
949034919 2:241811918-241811940 GCTGAGGGTCAGAGCCGCCGAGG + Intronic
1169203675 20:3728615-3728637 GCTCTGGATCTGAGCCTGAGGGG - Intergenic
1169235142 20:3924700-3924722 ACTCAGGATCAGGGCGTCAGAGG - Intronic
1169268569 20:4182295-4182317 GCTCAATCTCAGGGCCTCTGGGG - Exonic
1170834931 20:19875990-19876012 CCCCAGGCTCAAAGCCTCAGAGG - Intergenic
1172057570 20:32165076-32165098 CCTAATGCTCATAGCCTCAGGGG - Intronic
1172272807 20:33663966-33663988 GCTCAGCCTAGGAGCCGCAGAGG + Intronic
1173496736 20:43524786-43524808 GCAAAGGCACAGAGGCTCAGGGG + Intronic
1173591348 20:44227544-44227566 CCTCAGGGGCAGAACCTCAGAGG - Intergenic
1174118317 20:48243064-48243086 ACACACGCTCAGAGGCTCAGAGG + Intergenic
1174453230 20:50632258-50632280 ACTGAGGCCCAGAGCCTGAGTGG - Intronic
1174726417 20:52867345-52867367 ACTCAGGCTGAGAGCCTCTTAGG + Intergenic
1174927322 20:54774557-54774579 TGTCTGGCTCAGAGGCTCAGTGG + Intergenic
1175619634 20:60432665-60432687 TCTAAGGCTCAGACTCTCAGGGG + Intergenic
1175967427 20:62666441-62666463 GCTCAGGCTCCGGGGCTCCGCGG + Exonic
1176207743 20:63899065-63899087 GCAGAGGCTCAGAGTCACAGCGG - Intronic
1176385956 21:6138633-6138655 TCTCAGTTCCAGAGCCTCAGGGG + Intergenic
1177334951 21:19711529-19711551 GATCAGGATCAGAGACCCAGTGG - Intergenic
1178442814 21:32612469-32612491 GCTCAAGCTCAGAACCCGAGTGG + Exonic
1178511484 21:33208497-33208519 GATAAGGCTCAGAGAGTCAGAGG + Intergenic
1178781243 21:35604890-35604912 GCTCAGGCCCTGGGCCTCACAGG + Intronic
1178942047 21:36914495-36914517 GCTCAGGCTCAGACGCTGAAAGG + Intronic
1179737517 21:43399619-43399641 TCTCAGTTCCAGAGCCTCAGGGG - Intergenic
1180157326 21:45983911-45983933 CCTCAGGCTCAGGTGCTCAGAGG + Intronic
1181097020 22:20512399-20512421 GCTCAGTATCAGATACTCAGAGG + Intronic
1181167908 22:20993161-20993183 GCTCAGCACCAGAGCCTCACAGG + Intronic
1183458819 22:37937240-37937262 GGTCAGGCTCTGGGCCTCATGGG + Intronic
1183481740 22:38069081-38069103 GCTCAGGCCCAGAGCATCTGCGG - Exonic
1183530365 22:38350169-38350191 TCTCAAGCTCCTAGCCTCAGGGG + Intronic
1184595261 22:45509991-45510013 GCTCAAGCTCAAAAACTCAGAGG - Intronic
1184684918 22:46091907-46091929 GCTGAGGCTCAGAGCCGGGGAGG - Intronic
1185014110 22:48333510-48333532 GCTCGGGCGCAGAGCCTCGGGGG + Intergenic
1185074600 22:48676455-48676477 GCTCCCGCTCAGAGGCGCAGGGG + Intronic
1185221481 22:49631056-49631078 GCTCAGGGTGAGCCCCTCAGAGG - Intronic
1185364888 22:50432921-50432943 GCTCAGGCTCAGCACCCCAAGGG - Intronic
950484734 3:13266466-13266488 GCGCAGGGTCTGGGCCTCAGGGG - Intergenic
950518953 3:13485001-13485023 CCTTAGACTCAGAGCCACAGTGG + Intronic
951490497 3:23265586-23265608 GCATAGGCTCACTGCCTCAGAGG + Intronic
953794332 3:45972536-45972558 GAACAGGCTCAGAGGATCAGGGG - Intronic
955525721 3:59817880-59817902 GCTGAGGCTGAGAGCTTCAGGGG + Intronic
956074846 3:65494004-65494026 CCTTAAGCTCAGAGCCTAAGGGG + Intronic
963103307 3:141625171-141625193 GCACATGCTCAGTGCCTCTGTGG + Intergenic
964063607 3:152555516-152555538 GCTCTGAGTCTGAGCCTCAGCGG - Intergenic
964814962 3:160707164-160707186 GCCCAGCCTCAGCACCTCAGAGG - Intergenic
966916340 3:184586208-184586230 GCTCAGGGTCAGAGACTAAAAGG - Intronic
967094498 3:186165662-186165684 GCTCAGGCTCAGAGTCACTCAGG + Intronic
967117052 3:186351440-186351462 CCTCTGGCTCAGAGTCTCTGAGG + Intronic
968873141 4:3251547-3251569 GCTGAGGCCCAGAGCATGAGAGG + Intronic
969606201 4:8203478-8203500 TTTCAGGCTCAGAGCCTCGGGGG + Intronic
970300078 4:14671850-14671872 GCTCAGACTCAAAGACTCAAAGG - Intergenic
974545845 4:63306154-63306176 GCTCAGGTTCTGCTCCTCAGGGG + Intergenic
985527568 5:414997-415019 GGTCTGGCTCTCAGCCTCAGTGG - Intronic
985543419 5:497661-497683 GGTCAGGGTCAGCGGCTCAGGGG - Intronic
985653312 5:1117079-1117101 GCTCTGTCTCAGAGCCGCGGAGG + Intergenic
985907233 5:2849325-2849347 TCTGAGTCTCAGAGCCACAGTGG + Intergenic
987130620 5:14856782-14856804 GCTCATGCTTAGAGTCTCATAGG - Intronic
988275041 5:29069688-29069710 GCCCAGGTTTAGGGCCTCAGTGG + Intergenic
990129503 5:52564031-52564053 GCACAGGCACAGAGCACCAGAGG + Intergenic
992078584 5:73214085-73214107 GCTCAGGCTCAGAGGCCATGGGG + Intergenic
992260741 5:74967740-74967762 ACTCAGGCTCAGAATCTCACTGG + Intergenic
995143746 5:108763285-108763307 GCCCTGGGTCAGAGACTCAGAGG + Intronic
997364064 5:133314268-133314290 GCTCTGGCTAAGACCCTGAGGGG - Intronic
997804717 5:136905748-136905770 CCTTAGGCTAAAAGCCTCAGAGG + Intergenic
997976998 5:138446516-138446538 TCCTAGGCTCTGAGCCTCAGAGG + Exonic
999640161 5:153664431-153664453 GTTCAGAGTCAGAGCCACAGAGG - Intronic
1000239388 5:159395313-159395335 TCTCAGGCTCTGAGCTTCAGGGG + Intergenic
1003049881 6:2770322-2770344 GCTGTGGCTCAGAGGGTCAGTGG - Exonic
1005491972 6:26355419-26355441 CCCCAGGCTCAGTACCTCAGGGG + Intergenic
1005852662 6:29833408-29833430 GCTCTGGCTCTGAGACACAGGGG - Intergenic
1005876252 6:30011925-30011947 GCTCTGGCTCTGAGACACAGGGG - Intergenic
1006007744 6:31016649-31016671 GCTCAGTCTCGGAGCCTCCTCGG + Intronic
1007415625 6:41689655-41689677 CTCCAGGCTCAGAGCCACAGTGG + Intronic
1007915908 6:45561472-45561494 GCTCAGCTTCAGACCCTGAGTGG - Intronic
1010794825 6:80106726-80106748 ACTCAGGCTCAGGGCGGCAGGGG + Exonic
1011247419 6:85334255-85334277 GCCCAGCCACAGAACCTCAGAGG + Intergenic
1011637428 6:89387273-89387295 GGTAAAGCTCAGAGTCTCAGGGG - Exonic
1013225152 6:108115404-108115426 GCCCAGGCTCTGAGGCTTAGGGG - Intronic
1016280587 6:142413773-142413795 GCAGAGGCTCAGAGTCTGAGGGG - Intronic
1016411582 6:143788772-143788794 GCTCAGCCTGAGACCCACAGTGG + Exonic
1018981616 6:168606007-168606029 GCTCCGGGTCAGTGTCTCAGGGG - Intronic
1019318817 7:405671-405693 GTTCAGGCCCAGGGCCTGAGAGG - Intergenic
1019336258 7:484440-484462 GCTCAGGGCCAGAGCCTTGGGGG + Intergenic
1022100534 7:27166574-27166596 GCTCATGGTTAGAGCCTCTGAGG - Intronic
1022201847 7:28124532-28124554 ACTGAGGCTCAAAGCCACAGAGG + Intronic
1022728724 7:33003568-33003590 GGTCAGGCTCAGAGGCATAGAGG - Intronic
1022810942 7:33868406-33868428 GCTGAGACCCAGAGGCTCAGAGG + Intergenic
1024965026 7:55016906-55016928 GCTCTAGCTCACAGCCTCTGTGG - Intergenic
1025044925 7:55684421-55684443 GGTCAGGCTCAGAGGCATAGAGG + Intergenic
1026231334 7:68486490-68486512 GCTCAGGTACACAGCCTGAGAGG - Intergenic
1028138306 7:87245569-87245591 TCACAGGCCCAGAGGCTCAGGGG + Intergenic
1028338471 7:89687825-89687847 AGTCAGGCTGAGAACCTCAGTGG + Intergenic
1028516461 7:91682583-91682605 CCTCAGGATGGGAGCCTCAGAGG + Intergenic
1028898108 7:96064705-96064727 GCCCAAGCCCAGAGCATCAGAGG + Intronic
1029374803 7:100171232-100171254 GCTCAGGCTCAGGGATGCAGGGG + Intronic
1029777023 7:102689817-102689839 GGTCAGGGACAGAGCCTAAGGGG - Intergenic
1030351150 7:108489270-108489292 GATCAGACGCAGGGCCTCAGAGG - Intronic
1030886484 7:114944791-114944813 ACTCTGGCTCAGAGCTTCATGGG + Intronic
1034075295 7:148225637-148225659 TCTCAGGGTCAGAGGCCCAGTGG + Intronic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1035245846 7:157561522-157561544 GCAAAGGCTCAGGGCCCCAGAGG - Intronic
1036652607 8:10654924-10654946 GCTCAGCCCCTAAGCCTCAGGGG + Exonic
1037318256 8:17619245-17619267 GCTGAGGCTCTCAGCCTCAGGGG + Intronic
1038440152 8:27565818-27565840 GCTCTGGCTCAGATCTTCAGTGG - Intergenic
1038484543 8:27924468-27924490 GCTTAGGCTCAGAGGCTCACAGG + Intronic
1038522577 8:28246073-28246095 GAACAGCCTCAGAGCCTCATAGG + Intergenic
1039902563 8:41763683-41763705 GCTCAGGGACAGAGCCTGAGTGG - Intronic
1042130033 8:65579179-65579201 GCCCAATCTCAGACCCTCAGGGG + Intergenic
1042770090 8:72370589-72370611 GATCAGGTTCAGAGTTTCAGGGG - Intergenic
1047382168 8:124373216-124373238 GCTCAGTCTCAGACCCTCCTTGG - Intergenic
1049404230 8:142444499-142444521 GTGCAGGCTGAGAGCCACAGAGG + Intergenic
1049416954 8:142499663-142499685 GCTCAGGCCCTGGGCCTCCGGGG + Intronic
1049797106 8:144501837-144501859 GCTCAAGCTCACAGCCCCGGCGG + Exonic
1053123444 9:35562034-35562056 GCTGAGGCCCAGAGCATCATGGG + Exonic
1053267883 9:36729065-36729087 TCTCAGGGACAGAGCCCCAGAGG - Intergenic
1053421684 9:37983795-37983817 GATTAGGCTCAGGGCCCCAGCGG + Intronic
1053427168 9:38017702-38017724 GCTCAGGCTCTGAGTCCCAGTGG + Intronic
1055172121 9:73271521-73271543 GCTGTAGCTCAGAGACTCAGGGG - Intergenic
1055515902 9:77032606-77032628 GCTAAGCCTCAGAACCTCAGGGG - Intergenic
1058671904 9:107367074-107367096 CCTCAGGCTTACACCCTCAGAGG + Intergenic
1058800542 9:108540950-108540972 ACTCAGGCCCACAGCCTCATAGG + Intergenic
1061278200 9:129581631-129581653 GCTCCCTCTCTGAGCCTCAGGGG + Intergenic
1061502078 9:131009634-131009656 CCTCAGCCTCAGACCCCCAGTGG - Intronic
1062085997 9:134648832-134648854 GCTCAGGCTCAGAGCCTCAGAGG - Intronic
1062195832 9:135273444-135273466 GCTGAGGCTCAGAGAGGCAGGGG + Intergenic
1062200090 9:135298068-135298090 GCTCAGCCACAGAACCTCCGAGG - Intergenic
1062307792 9:135919556-135919578 GCTGAGGCTCCAACCCTCAGCGG - Intergenic
1186210469 X:7245179-7245201 GCTCAGGGTTGGAGCATCAGGGG - Intronic
1187916104 X:24153400-24153422 GAGCAGGCTCAGAGCAGCAGTGG - Intronic
1189137065 X:38561285-38561307 GCGCAGGCTTAGACCCCCAGCGG - Intronic
1190066422 X:47244734-47244756 GCTCTGGCTCAGGGTCTCGGAGG - Exonic
1191155710 X:57270761-57270783 CCTCAGGCTTAGACCCTCATGGG - Intergenic
1198379527 X:136070807-136070829 GCTCAGGCCAAAAGCCTCAGGGG - Intergenic
1199805383 X:151294730-151294752 GATCAGTCTGAGGGCCTCAGTGG - Intergenic