ID: 1062086221

View in Genome Browser
Species Human (GRCh38)
Location 9:134650328-134650350
Sequence TCTGCTGGCGGGTGGCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062086210_1062086221 8 Left 1062086210 9:134650297-134650319 CCGTCTTCCATTGGAAGCGACCG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1062086221 9:134650328-134650350 TCTGCTGGCGGGTGGCCTGGGGG No data
1062086211_1062086221 1 Left 1062086211 9:134650304-134650326 CCATTGGAAGCGACCGTCTTCCA 0: 1
1: 0
2: 0
3: 3
4: 38
Right 1062086221 9:134650328-134650350 TCTGCTGGCGGGTGGCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062086221 Original CRISPR TCTGCTGGCGGGTGGCCTGG GGG Intronic
No off target data available for this crispr