ID: 1062086659

View in Genome Browser
Species Human (GRCh38)
Location 9:134652657-134652679
Sequence CTGCAGGAATCGTGGGATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062086644_1062086659 27 Left 1062086644 9:134652607-134652629 CCACAGTGCACGGGACAGCCCCC 0: 1
1: 6
2: 33
3: 118
4: 349
Right 1062086659 9:134652657-134652679 CTGCAGGAATCGTGGGATAGAGG No data
1062086653_1062086659 -10 Left 1062086653 9:134652644-134652666 CCCAGCCCGGAGGCTGCAGGAAT 0: 1
1: 0
2: 1
3: 24
4: 165
Right 1062086659 9:134652657-134652679 CTGCAGGAATCGTGGGATAGAGG No data
1062086643_1062086659 28 Left 1062086643 9:134652606-134652628 CCCACAGTGCACGGGACAGCCCC 0: 1
1: 47
2: 278
3: 728
4: 1522
Right 1062086659 9:134652657-134652679 CTGCAGGAATCGTGGGATAGAGG No data
1062086642_1062086659 29 Left 1062086642 9:134652605-134652627 CCCCACAGTGCACGGGACAGCCC 0: 1
1: 1
2: 12
3: 99
4: 323
Right 1062086659 9:134652657-134652679 CTGCAGGAATCGTGGGATAGAGG No data
1062086648_1062086659 6 Left 1062086648 9:134652628-134652650 CCACCAAAAAGACTGACCCAGCC 0: 1
1: 0
2: 0
3: 22
4: 252
Right 1062086659 9:134652657-134652679 CTGCAGGAATCGTGGGATAGAGG No data
1062086645_1062086659 9 Left 1062086645 9:134652625-134652647 CCCCCACCAAAAAGACTGACCCA 0: 1
1: 0
2: 2
3: 25
4: 254
Right 1062086659 9:134652657-134652679 CTGCAGGAATCGTGGGATAGAGG No data
1062086649_1062086659 3 Left 1062086649 9:134652631-134652653 CCAAAAAGACTGACCCAGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1062086659 9:134652657-134652679 CTGCAGGAATCGTGGGATAGAGG No data
1062086646_1062086659 8 Left 1062086646 9:134652626-134652648 CCCCACCAAAAAGACTGACCCAG 0: 1
1: 0
2: 2
3: 30
4: 233
Right 1062086659 9:134652657-134652679 CTGCAGGAATCGTGGGATAGAGG No data
1062086647_1062086659 7 Left 1062086647 9:134652627-134652649 CCCACCAAAAAGACTGACCCAGC 0: 1
1: 0
2: 1
3: 21
4: 183
Right 1062086659 9:134652657-134652679 CTGCAGGAATCGTGGGATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062086659 Original CRISPR CTGCAGGAATCGTGGGATAG AGG Intronic
No off target data available for this crispr