ID: 1062086680

View in Genome Browser
Species Human (GRCh38)
Location 9:134652768-134652790
Sequence TACACCATGAGGAGAAACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062086680_1062086687 23 Left 1062086680 9:134652768-134652790 CCAGCGTTTCTCCTCATGGTGTA 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1062086687 9:134652814-134652836 CAGGCCCCAGAATCCCCCCGAGG No data
1062086680_1062086683 4 Left 1062086680 9:134652768-134652790 CCAGCGTTTCTCCTCATGGTGTA 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1062086683 9:134652795-134652817 AGCAGTTCCCAAACTTTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062086680 Original CRISPR TACACCATGAGGAGAAACGC TGG (reversed) Intronic
901049008 1:6416918-6416940 TACTCCATGAGGACAAATACTGG - Exonic
905714156 1:40133538-40133560 TACAACATGTGGATAAACCCAGG - Intergenic
910427908 1:87133987-87134009 GACACCAAAAGGAGAAACTCTGG + Intronic
917159472 1:172041344-172041366 TCCACCATGAGGAGAGACTTGGG + Intronic
919516516 1:198532217-198532239 TACAGAATGAGGAGAAAAGAAGG + Intronic
1066120925 10:32286460-32286482 TCCACCTTGGGGAGAAAAGCAGG + Intronic
1067058086 10:43064054-43064076 GAGACCATGAGGAGAGACGTGGG - Intergenic
1068388064 10:56358569-56358591 GACACCATGGGGAGAGACCCTGG - Exonic
1070786096 10:79162971-79162993 CACCCCATGATGAGAAATGCTGG - Intronic
1073197428 10:101704380-101704402 TCCACCATGAAGAGAAAAGCAGG + Intergenic
1077777387 11:5286448-5286470 TACACCATGTGGAGAAGGGGTGG - Intronic
1088186111 11:107173015-107173037 TAGAGCAGGAGGTGAAACGCTGG + Intergenic
1097265394 12:57741415-57741437 TACACCATGCAGAGAATCTCAGG - Intronic
1097762454 12:63483251-63483273 TACAGCACCAGGAGAAAGGCTGG - Intergenic
1100175683 12:92028402-92028424 AAGACCAAGAGGAGAAATGCTGG - Intronic
1110285448 13:73744669-73744691 TAGACACTGAGGAGCAACGCAGG + Intronic
1110449573 13:75626414-75626436 TTCACTATGACGAGAAAAGCAGG + Intronic
1112731946 13:102372965-102372987 TACACCATGAGTAGGAAGGGAGG + Intronic
1145982892 17:29024639-29024661 TTCTCCATGAAGAGAAAAGCAGG + Intronic
1154311320 18:13268548-13268570 GACGCCAAGAGGGGAAACGCTGG - Intronic
1161073355 19:2273192-2273214 TACAACATGCGGACAAACCCAGG - Exonic
1163923484 19:20315845-20315867 CACACATTGAGGAGAAATGCAGG + Intergenic
1164144683 19:22504760-22504782 TGCCCCATGAGGAGAAAGGGAGG + Intronic
927725503 2:25419367-25419389 AACACCATGGGGAGAACCGCTGG + Intronic
930321405 2:49858862-49858884 TAGGCCATGAGGGGAAACTCAGG - Intergenic
931748869 2:65313789-65313811 TCAACCACGAGGAGAACCGCCGG - Exonic
935446818 2:103166217-103166239 AACACCAGGAGGGGAAAGGCAGG + Intergenic
936710331 2:115123533-115123555 TGCACCAAGAGGAAAAACGGTGG - Intronic
942707500 2:178793161-178793183 TACACCAGGAGTAGAAACAGGGG - Intronic
945053262 2:205846055-205846077 TACACCAGGAGTAGAACTGCTGG - Intergenic
947717998 2:232351464-232351486 GGCACCATGAGGAGGGACGCAGG + Intergenic
948670814 2:239567467-239567489 TCCACCATGAGAACAAAAGCAGG + Intergenic
1172290123 20:33770066-33770088 TACACCTTGAGGGAAGACGCTGG - Exonic
1179080396 21:38165591-38165613 GACAGCATGATGAGAAAGGCAGG - Intronic
1180637147 22:17270217-17270239 TGCACCATGAGGAGAAGGTCTGG + Intergenic
1180975799 22:19847491-19847513 CACCCCATGAGGAAAAACTCTGG + Exonic
1181858609 22:25800759-25800781 TGCCCCAGGAGGAGAAACTCAGG - Intronic
1183921894 22:41176488-41176510 AGCACCATGTGGAGACACGCTGG + Exonic
950585638 3:13890439-13890461 TACAACATGAGGGGAAGCCCTGG - Intergenic
955465719 3:59235349-59235371 TACTCCTTGATGAGAAACTCTGG - Intergenic
955908286 3:63830839-63830861 TACAGCATCAGGAAAAAAGCAGG - Intronic
964295845 3:155232327-155232349 TACACCATGATCAGAAAGGCGGG - Intergenic
965968573 3:174526393-174526415 TATACCATGATGAGAAAACCGGG - Intronic
965969071 3:174531149-174531171 TACACCATGCATAGAAACACGGG - Intronic
970088637 4:12377122-12377144 TGCACCATGAAGATAAAAGCAGG - Intergenic
976222030 4:82763611-82763633 GACACCCAGAGGAGAAACCCAGG + Intronic
979088906 4:116453105-116453127 TACACCAGGACAAGAAACCCGGG - Intergenic
979947829 4:126856121-126856143 TACACCATTTAGAGAAACACTGG + Intergenic
981020905 4:140027249-140027271 TACACCATGAGGAAAACAACTGG - Intronic
981475562 4:145183362-145183384 TACAACCTCAGGAGAAACCCTGG + Intergenic
982004224 4:151049152-151049174 TACACCATGGCAAGAAACCCCGG - Intergenic
982095965 4:151923693-151923715 AACACCATGAACAGAAACTCTGG + Intergenic
983296707 4:165875302-165875324 TACACAATGAAGAAAAATGCTGG + Intronic
984472772 4:180197540-180197562 GAAACCAGCAGGAGAAACGCAGG + Intergenic
985441297 4:189984062-189984084 CTCACCTTGAGGAGACACGCGGG + Intergenic
994762837 5:103878306-103878328 TACACCAAGAGGAGATTGGCTGG - Intergenic
998804880 5:145908370-145908392 TACACAAGGAGGAGCAAGGCAGG + Intergenic
999824683 5:155262814-155262836 TATAGCATGAGGATAAACGAGGG - Intergenic
1000194247 5:158942710-158942732 TACACTGTAAGGAGAAATGCTGG + Intronic
1000464832 5:161562915-161562937 TGCACCATGAGGAAAAATGAAGG - Intronic
1001029046 5:168248263-168248285 TATACCATGTGGAAAAACGTGGG + Exonic
1002410582 5:179071990-179072012 TACACAATGTGTAGAAACTCTGG - Intronic
1003164977 6:3669810-3669832 CACACCATGAGGGGAACCTCAGG - Intergenic
1005131877 6:22518065-22518087 GACACCATTAGGAGAACAGCAGG + Intergenic
1006382507 6:33708072-33708094 GACACCAGGCGGAGAAAAGCTGG - Intronic
1010123159 6:72403193-72403215 TATACTATGACGAGAGACGCAGG - Intergenic
1013878675 6:114866379-114866401 TACAACATGAGGACAACCCCTGG + Intergenic
1028649226 7:93131985-93132007 TACTCCAGGAGGAGAATTGCAGG - Exonic
1032654668 7:133914823-133914845 TACACCATCATGAGAAAAGAAGG + Intronic
1045230232 8:100298882-100298904 TACACCATTAGGAAAACCACAGG + Intronic
1046590313 8:116198377-116198399 TACACCAAGACAAGAAACCCTGG - Intergenic
1048082961 8:131148776-131148798 TACACCAAGGCGAGAAACCCTGG - Intergenic
1048519855 8:135143336-135143358 CATACCAAGAGGAGAAACTCAGG + Intergenic
1048652075 8:136489220-136489242 TACACACTGAGGAAAAACTCAGG + Intergenic
1048750763 8:137671673-137671695 ACCACCATGTGGAGAAACCCAGG + Intergenic
1056897593 9:90565438-90565460 TGCACCATCAGGAGAAACCCTGG - Intergenic
1057723219 9:97549291-97549313 TAGACCATGAGGACAAAGACAGG - Intronic
1058218455 9:102264254-102264276 AACACCATGGGGAGAACCCCCGG + Intergenic
1062086680 9:134652768-134652790 TACACCATGAGGAGAAACGCTGG - Intronic
1062680669 9:137778110-137778132 GACACCATGGGGAAAAACGCGGG - Intronic
1190221946 X:48517350-48517372 GAAACCATGAGGACAAAGGCTGG + Intronic
1191145120 X:57157387-57157409 TACTCCAGTAGGAGAAACCCAGG - Intergenic
1195040524 X:101009971-101009993 CACACCATAAGCAGAAACGGAGG + Exonic
1196349989 X:114717524-114717546 TAAAACATGAGTAGAAATGCTGG + Intronic
1197169615 X:123416937-123416959 TACACCATGAGGTGCCACACAGG - Intronic
1199666488 X:150100274-150100296 AACACCATGAGGAGAAAGTGAGG + Intergenic