ID: 1062088497

View in Genome Browser
Species Human (GRCh38)
Location 9:134661419-134661441
Sequence GTCCTGTGGGCAGATGCTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062088490_1062088497 20 Left 1062088490 9:134661376-134661398 CCAGTTTGCAGCAGGGCGTGTGT 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1062088497 9:134661419-134661441 GTCCTGTGGGCAGATGCTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062088497 Original CRISPR GTCCTGTGGGCAGATGCTGA CGG Intronic
No off target data available for this crispr