ID: 1062090099

View in Genome Browser
Species Human (GRCh38)
Location 9:134671567-134671589
Sequence CTGAGTCAGCAGAGCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062090097_1062090099 28 Left 1062090097 9:134671516-134671538 CCACAATGTTCCTTTACTTGCAT 0: 1
1: 0
2: 0
3: 23
4: 220
Right 1062090099 9:134671567-134671589 CTGAGTCAGCAGAGCCAGAGAGG No data
1062090098_1062090099 18 Left 1062090098 9:134671526-134671548 CCTTTACTTGCATCAAAGAACTG 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1062090099 9:134671567-134671589 CTGAGTCAGCAGAGCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062090099 Original CRISPR CTGAGTCAGCAGAGCCAGAG AGG Intronic
No off target data available for this crispr