ID: 1062092580

View in Genome Browser
Species Human (GRCh38)
Location 9:134686221-134686243
Sequence AAGGAGAAGGAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10315
Summary {0: 4, 1: 71, 2: 432, 3: 1993, 4: 7815}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062092580_1062092585 14 Left 1062092580 9:134686221-134686243 CCTTCCTCCTTCTCCTTCTCCTT 0: 4
1: 71
2: 432
3: 1993
4: 7815
Right 1062092585 9:134686258-134686280 TCTTCCTTTTTTTCGAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062092580 Original CRISPR AAGGAGAAGGAGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr