ID: 1062092847

View in Genome Browser
Species Human (GRCh38)
Location 9:134687594-134687616
Sequence CCTTCTGTGCATCAGATGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062092842_1062092847 23 Left 1062092842 9:134687548-134687570 CCATGGAATCAACAAAGTTTTTG 0: 1
1: 0
2: 2
3: 17
4: 230
Right 1062092847 9:134687594-134687616 CCTTCTGTGCATCAGATGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062092847 Original CRISPR CCTTCTGTGCATCAGATGGT CGG Intronic
No off target data available for this crispr