ID: 1062093044

View in Genome Browser
Species Human (GRCh38)
Location 9:134688601-134688623
Sequence GTGGCTTTCGGCTGCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 107}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062093044_1062093057 25 Left 1062093044 9:134688601-134688623 CCTGCTTGGCAGCCGAAAGCCAC 0: 1
1: 0
2: 1
3: 5
4: 107
Right 1062093057 9:134688649-134688671 GGCCTGGACGTGGGGTGTTCTGG No data
1062093044_1062093056 17 Left 1062093044 9:134688601-134688623 CCTGCTTGGCAGCCGAAAGCCAC 0: 1
1: 0
2: 1
3: 5
4: 107
Right 1062093056 9:134688641-134688663 CCATGAGAGGCCTGGACGTGGGG No data
1062093044_1062093052 9 Left 1062093044 9:134688601-134688623 CCTGCTTGGCAGCCGAAAGCCAC 0: 1
1: 0
2: 1
3: 5
4: 107
Right 1062093052 9:134688633-134688655 CAGAGAGGCCATGAGAGGCCTGG No data
1062093044_1062093054 16 Left 1062093044 9:134688601-134688623 CCTGCTTGGCAGCCGAAAGCCAC 0: 1
1: 0
2: 1
3: 5
4: 107
Right 1062093054 9:134688640-134688662 GCCATGAGAGGCCTGGACGTGGG No data
1062093044_1062093047 -6 Left 1062093044 9:134688601-134688623 CCTGCTTGGCAGCCGAAAGCCAC 0: 1
1: 0
2: 1
3: 5
4: 107
Right 1062093047 9:134688618-134688640 AGCCACCCAGGAAAACAGAGAGG No data
1062093044_1062093051 4 Left 1062093044 9:134688601-134688623 CCTGCTTGGCAGCCGAAAGCCAC 0: 1
1: 0
2: 1
3: 5
4: 107
Right 1062093051 9:134688628-134688650 GAAAACAGAGAGGCCATGAGAGG No data
1062093044_1062093058 26 Left 1062093044 9:134688601-134688623 CCTGCTTGGCAGCCGAAAGCCAC 0: 1
1: 0
2: 1
3: 5
4: 107
Right 1062093058 9:134688650-134688672 GCCTGGACGTGGGGTGTTCTGGG No data
1062093044_1062093053 15 Left 1062093044 9:134688601-134688623 CCTGCTTGGCAGCCGAAAGCCAC 0: 1
1: 0
2: 1
3: 5
4: 107
Right 1062093053 9:134688639-134688661 GGCCATGAGAGGCCTGGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062093044 Original CRISPR GTGGCTTTCGGCTGCCAAGC AGG (reversed) Intronic
903658849 1:24964926-24964948 GGGGCTTTCGGCAGCCAGGGTGG + Exonic
904818908 1:33227673-33227695 GTTGCTTTGTTCTGCCAAGCTGG + Intergenic
907272150 1:53297470-53297492 GTGGCTTTGTACTGCCCAGCGGG + Intronic
913595480 1:120371959-120371981 GTTGCTTTCTGCTTCCAAGATGG - Intergenic
914091796 1:144507016-144507038 GTTGCTTTCTGCTTCCAAGATGG + Intergenic
914306745 1:146426848-146426870 GTTGCTTTCTGCTTCCAAGATGG - Intergenic
914595304 1:149145954-149145976 GTTGCTTTCTGCTTCCAAGATGG + Intergenic
914689242 1:150010725-150010747 GTGGCTTTCTGCTGTCCGGCCGG + Intergenic
917452220 1:175156602-175156624 GTGGCTAGCGGCTGCCATCCTGG - Intergenic
920704753 1:208243222-208243244 GTGGCTTTGGGCTGTCTCGCTGG + Intronic
922754676 1:228089109-228089131 GGGGGTTTCGGCTGCAAAGCTGG + Intronic
924181870 1:241446925-241446947 GTGGCTCTCTGCTTCCAAGATGG - Intergenic
1064971614 10:21072550-21072572 GGGGCTGTCGGCTGCCACACAGG + Intronic
1065875620 10:29995056-29995078 GTTGCCTTTGGCTGCAAAGCTGG + Intergenic
1067144052 10:43680895-43680917 GTGGTATTCAGCTGGCAAGCAGG - Intergenic
1067397211 10:45932844-45932866 GTGGCTGCCGGCTGCCATCCTGG - Intergenic
1067865530 10:49901945-49901967 GTGGCTGCCGGCTGCCATCCTGG - Intronic
1073475737 10:103751897-103751919 GTGACTGTCTGCTGCCCAGCCGG + Intronic
1087874805 11:103342749-103342771 GTGGCTTTGGGAGGCCAAGGCGG - Intronic
1090967349 11:131610470-131610492 GTGGATCTCGCCTGCCCAGCTGG - Intronic
1101898799 12:108775779-108775801 GTAGCTCTCGGGTGCCAGGCAGG - Intergenic
1103241541 12:119417473-119417495 TTGGCTTTTGGCTGACAGGCAGG + Intronic
1113594936 13:111524510-111524532 GTGGTTTTGAGCTGCCCAGCTGG + Intergenic
1117656231 14:57959604-57959626 ATGGCTTTCGGCTGCGAAAGTGG - Intronic
1121797825 14:96750186-96750208 GTGGCTTACGGCTACCATACTGG - Intergenic
1121818401 14:96945509-96945531 ATGGCTTTCCCCTTCCAAGCTGG + Intergenic
1121852209 14:97231975-97231997 GTAGCTTTTGGCTACCAAACTGG + Intergenic
1121954202 14:98199171-98199193 GTGGCTTACAGCTCTCAAGCAGG + Intergenic
1122136407 14:99635386-99635408 GTGGCTTTGGACTGAGAAGCCGG + Intergenic
1122619052 14:103043068-103043090 GTGGCTTTTGGCCGCCTAGTTGG - Intronic
1125713140 15:41803456-41803478 GTGGCTTTGGGAAGCCAAGGTGG + Intronic
1126803132 15:52319011-52319033 GTGTCTTTTTGCTGCCCAGCTGG - Intronic
1127498628 15:59535649-59535671 GGGGCTTTCTGGTGTCAAGCAGG + Intergenic
1128082091 15:64862696-64862718 GTGACTTGCGGCTGCCAACCTGG - Intronic
1131841682 15:96444008-96444030 GTCGCTTTCTGCTTCCAAGATGG + Intergenic
1132809791 16:1792072-1792094 GTGGCTCCAGGCTGCCCAGCTGG + Exonic
1143378916 17:6483639-6483661 GTGGATGTCGGCTGCCTTGCAGG + Exonic
1145977725 17:28993869-28993891 GAGGCTTGGGGCTGCCAGGCCGG - Intronic
1147566343 17:41538684-41538706 CTGGCTTTAGGCTGGCAAGCGGG + Intergenic
1148222090 17:45870194-45870216 GAGGATTTCGGCTGCACAGCAGG + Intergenic
1148832868 17:50446503-50446525 GTGGCTTTGGGATGCCGAGGTGG - Intronic
1150693921 17:67387966-67387988 GTGGCTTGTGGCTGCCATACTGG + Intronic
1151712735 17:75816126-75816148 GTGGCTTTCGGCTGCCTTGTGGG + Intronic
1152279543 17:79377143-79377165 CTGGCTTTCCACTGCCCAGCTGG + Intronic
1152670324 17:81600313-81600335 GAGGCATCCGGCAGCCAAGCAGG - Intronic
1156375639 18:36512866-36512888 GTGGCTTTCTGCTGAGATGCAGG - Intronic
1160288859 18:77572113-77572135 GTGGCTCTCCTCTGTCAAGCAGG + Intergenic
1160891437 19:1380768-1380790 GTGGCATTCTGCTGCAAAGGGGG - Intergenic
1165866418 19:38942236-38942258 CTGGCTTCTGGCTGCAAAGCTGG + Exonic
1168403513 19:56099202-56099224 GGGGCTTTGGGCTGCCCTGCAGG - Intronic
925545110 2:5007273-5007295 GTGGTTTTGGGCTGCAAACCTGG + Intergenic
932468128 2:71936521-71936543 CTGGCCTTCGGCTCCCAGGCAGG + Intergenic
938235149 2:129699776-129699798 GTGGCCTCCAGCTGTCAAGCAGG - Intergenic
938251908 2:129821959-129821981 GTGTCTTTCGCCTGCCACCCTGG - Intergenic
939585028 2:143993736-143993758 GTTGTTTTAGGCTGCCAAGTTGG + Intronic
941850365 2:170174012-170174034 GTGGCTTTGGGAGGCCAAGGTGG - Intergenic
942078496 2:172379197-172379219 GTGCCATTCGGCTCCCCAGCTGG - Intergenic
1169700565 20:8442321-8442343 GTGGCTCTCTGCTTCCAAGATGG + Intronic
1170410229 20:16081850-16081872 GTGGCTATTGGCTTCCAAGCAGG - Intergenic
1172629535 20:36368602-36368624 GTTGCTTTTGGCTGAGAAGCTGG + Intronic
1173142982 20:40500881-40500903 GTGGCTCATGGCTGCCATGCTGG + Intergenic
1173781153 20:45758520-45758542 CTGGCTGTGGGCTGCCAGGCAGG - Intronic
1175524426 20:59623797-59623819 GTGGCTTGGGCCTGCCACGCGGG + Intronic
1179722444 21:43323430-43323452 TGGCCGTTCGGCTGCCAAGCTGG - Intergenic
1184470494 22:44692891-44692913 GTGGTGTTAGGCTGCCAGGCTGG + Intronic
949251735 3:1993264-1993286 GTGGCTAGTGGCTGCCATGCTGG + Intergenic
950333886 3:12178395-12178417 GTGGCTTTCGGCAGACAAGCTGG - Intronic
950456772 3:13097388-13097410 GTGGAGTATGGCTGCCAAGCTGG - Intergenic
951495813 3:23325000-23325022 ATTGCTTTCTGCCGCCAAGCAGG + Intronic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
958027742 3:88068854-88068876 CTGGCTTTTGGCTGTCAAACTGG - Intronic
961032354 3:123617716-123617738 GTGACTTTCACCTGCCAACCAGG - Intronic
962970662 3:140398879-140398901 GTGTCTTTCTGCTGAGAAGCAGG + Intronic
963249576 3:143090643-143090665 GAGGCTTGCTGCTGGCAAGCGGG - Intergenic
965757862 3:172042756-172042778 GTGGCTTGTGGCTGCTATGCTGG - Intronic
973844009 4:54892458-54892480 ATCTCTTTCTGCTGCCAAGCAGG + Intergenic
977561458 4:98537438-98537460 GTGGCTTCTGGCTGGCAAGATGG - Intronic
981695924 4:147558618-147558640 GTGGCTGTCAGCTGTCATGCCGG - Intergenic
983432704 4:167671523-167671545 GTGGCTTTGGGAGGCCAAGGCGG - Intergenic
983756267 4:171340940-171340962 GTGCATTACAGCTGCCAAGCAGG - Intergenic
990448966 5:55917875-55917897 GTGCCTTTCTGCTCCCAGGCTGG - Intronic
993244986 5:85439512-85439534 GTAGCTTTCTGCTGCAAACCAGG + Intergenic
998151626 5:139760645-139760667 GTGGCTTTCTTCTTCCAGGCAGG + Intergenic
998375455 5:141687592-141687614 GTGGCTACCGGCTGCCATACTGG - Intergenic
999733547 5:154494419-154494441 TTGCCTTTTGGCTCCCAAGCTGG - Intergenic
1002648320 5:180673396-180673418 GTGACATTCAGCAGCCAAGCAGG - Intergenic
1002681393 5:180968120-180968142 CTGGCTTTGGGCTGTCAGGCAGG - Intergenic
1002890417 6:1326970-1326992 TGGGCTTTCGGCTCCTAAGCAGG - Intergenic
1003065807 6:2902990-2903012 GTGGCTGTGGGCCGCCAAGGCGG + Intronic
1013806585 6:114002783-114002805 ATATCTTTCAGCTGCCAAGCAGG + Intronic
1017763273 6:157587519-157587541 GTGGCCTTGCCCTGCCAAGCAGG - Intronic
1019513358 7:1429309-1429331 GAGGCTGACGGCTGCCATGCAGG - Intronic
1020899665 7:13989641-13989663 GGCGCTTTCGGCTTCCAAGGGGG - Exonic
1021214974 7:17904664-17904686 ATGGCTTAAGGCTGCCAAACAGG + Intronic
1030515050 7:110528498-110528520 GTGGCTTTCCTCTGGAAAGCAGG - Intergenic
1032454614 7:132063923-132063945 ATGGCTTTGGGCTCCCAAGATGG - Intergenic
1034963633 7:155377984-155378006 GGGGCTTCCGGGGGCCAAGCCGG - Intergenic
1036184893 8:6614353-6614375 ATAGCTTTCCGCTGCCAGGCTGG + Intronic
1037284245 8:17280260-17280282 TTGTCTTTTGGCTTCCAAGCTGG - Exonic
1045957804 8:107929412-107929434 CTGGCTTTCAGCTGCTAAACAGG - Intronic
1047207143 8:122811661-122811683 GTGGCTGTCACCTGCCAATCAGG + Intronic
1049344766 8:142132931-142132953 GTGGCTTTCGCTTCCCCAGCCGG - Intergenic
1053024065 9:34715945-34715967 CTGGCTCTTGCCTGCCAAGCTGG - Intergenic
1053035526 9:34824110-34824132 GTGGCTCTTACCTGCCAAGCTGG - Intergenic
1053297069 9:36922723-36922745 GTGGCTTTAAGCTGCACAGCGGG - Intronic
1053461303 9:38273408-38273430 GTGGCTGTCCTCTGCCAACCAGG + Intergenic
1056758446 9:89397479-89397501 GGGCCTTTCTGATGCCAAGCCGG - Intronic
1060925274 9:127451527-127451549 GAGGCTGACGGCTGGCAAGCAGG + Exonic
1061268083 9:129519989-129520011 GTGACTTTCTGCTGCCCAGGAGG - Intergenic
1061841863 9:133363252-133363274 GAGGCTTCCAGCTGCCAGGCTGG + Exonic
1062093044 9:134688601-134688623 GTGGCTTTCGGCTGCCAAGCAGG - Intronic
1189988395 X:46573693-46573715 GGGGCGGGCGGCTGCCAAGCCGG + Intergenic
1199451180 X:147980723-147980745 GTGGCTTATGGCTGCCATCCTGG - Intergenic
1200750512 Y:6940436-6940458 GAGGCTTTGGGAGGCCAAGCAGG - Intronic