ID: 1062095915

View in Genome Browser
Species Human (GRCh38)
Location 9:134703305-134703327
Sequence CACAGGAGCCGTCCTCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062095905_1062095915 28 Left 1062095905 9:134703254-134703276 CCGGGCACACTTCTGAACAGACC 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1062095915 9:134703305-134703327 CACAGGAGCCGTCCTCAGCCAGG No data
1062095910_1062095915 3 Left 1062095910 9:134703279-134703301 CCTAGGCGCCTGGAAGGAACTGC 0: 1
1: 0
2: 0
3: 11
4: 137
Right 1062095915 9:134703305-134703327 CACAGGAGCCGTCCTCAGCCAGG No data
1062095909_1062095915 7 Left 1062095909 9:134703275-134703297 CCTGCCTAGGCGCCTGGAAGGAA 0: 1
1: 0
2: 0
3: 13
4: 147
Right 1062095915 9:134703305-134703327 CACAGGAGCCGTCCTCAGCCAGG No data
1062095913_1062095915 -5 Left 1062095913 9:134703287-134703309 CCTGGAAGGAACTGCGGGCACAG 0: 1
1: 0
2: 0
3: 15
4: 222
Right 1062095915 9:134703305-134703327 CACAGGAGCCGTCCTCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062095915 Original CRISPR CACAGGAGCCGTCCTCAGCC AGG Intronic
No off target data available for this crispr