ID: 1062099994

View in Genome Browser
Species Human (GRCh38)
Location 9:134723069-134723091
Sequence CGGGGGCTGTGACCCACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062099994_1062099997 -10 Left 1062099994 9:134723069-134723091 CCCTTTGTGGGTCACAGCCCCCG 0: 1
1: 0
2: 1
3: 7
4: 114
Right 1062099997 9:134723082-134723104 ACAGCCCCCGAGGTGAAGTCTGG No data
1062099994_1062099999 -6 Left 1062099994 9:134723069-134723091 CCCTTTGTGGGTCACAGCCCCCG 0: 1
1: 0
2: 1
3: 7
4: 114
Right 1062099999 9:134723086-134723108 CCCCCGAGGTGAAGTCTGGAAGG No data
1062099994_1062100003 -1 Left 1062099994 9:134723069-134723091 CCCTTTGTGGGTCACAGCCCCCG 0: 1
1: 0
2: 1
3: 7
4: 114
Right 1062100003 9:134723091-134723113 GAGGTGAAGTCTGGAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062099994 Original CRISPR CGGGGGCTGTGACCCACAAA GGG (reversed) Intronic
901259217 1:7859384-7859406 CGGGGCCTGTGACCCCCTCAGGG - Intergenic
901786167 1:11626239-11626261 CGGGGGCTGTGACAGAGAAGAGG + Intergenic
904601185 1:31673365-31673387 AGGGGTCTGTGACCCAAAGAAGG - Intronic
905105508 1:35561298-35561320 AGGGTGCAGTGACCCACAGAGGG + Intronic
909999273 1:82322829-82322851 CAGGGGCTGTCAAACACAAAGGG - Intergenic
915041437 1:152971279-152971301 AGGGTGCTGAGACCCACAGAAGG + Intronic
924739409 1:246786031-246786053 CAGGGGCTATGACCTACAGAAGG - Intergenic
1067545579 10:47190183-47190205 TGGGGGCTGTGACCCAAGAATGG - Intergenic
1071464142 10:85924054-85924076 CAGGTGCTGTGTCCCACAAGTGG - Intronic
1075444354 10:122503445-122503467 CTGGGGCCGTGACCCCCAAAAGG + Intronic
1075623995 10:123948589-123948611 TGGTGGCTGTGGCCCAGAAAAGG - Intergenic
1077108649 11:852703-852725 AGGGGGCTGGCACCCCCAAAAGG - Intronic
1077314259 11:1910042-1910064 CTGCGGCTGTGAGCCACCAATGG - Intergenic
1084263612 11:67993882-67993904 CCGGGGCTGGGACCCATACAGGG - Intronic
1084657308 11:70527097-70527119 CTGGTGTTCTGACCCACAAACGG + Intronic
1084685098 11:70688747-70688769 AGGGGGCAGTGAGGCACAAAGGG - Intronic
1085021625 11:73213652-73213674 TGGGGGCTGGGACAGACAAATGG - Intergenic
1086458441 11:86982311-86982333 ATGGGCATGTGACCCACAAAGGG + Intergenic
1088433408 11:109783305-109783327 AGGGGGGTGTGAACCAAAAAAGG - Intergenic
1096465318 12:51845444-51845466 GGGGGGCGGTGAGCCACAAGAGG - Intergenic
1096481714 12:51946185-51946207 ACAAGGCTGTGACCCACAAAGGG - Intergenic
1103951638 12:124554605-124554627 CGGGGGCTGTGACACAGAGAGGG + Intronic
1104982007 12:132577353-132577375 CGGGGGCTGGGAGACAGAAAGGG - Intronic
1109348545 13:61146073-61146095 CTGGGTCTGGGCCCCACAAAAGG - Intergenic
1112721584 13:102251958-102251980 CAGAGGCTATGACCCACAAATGG + Intronic
1114187333 14:20413047-20413069 CAGTGGCTGTCACCAACAAATGG - Intronic
1120010011 14:79403176-79403198 TGGAGGCTGGGACCCAGAAAAGG + Intronic
1121840471 14:97129734-97129756 GGGGGACTGTGCCCCAGAAAAGG - Intergenic
1122357610 14:101132862-101132884 CTGGGGCTGTCACCCATGAAAGG + Intergenic
1122661320 14:103297539-103297561 CGGGGGCTGGGACTCACTGAAGG - Intergenic
1123700894 15:22914146-22914168 CAGAGGCTGTGTCACACAAAAGG + Intronic
1124085787 15:26549357-26549379 AGGGGGCTGTGACACAGGAAGGG + Intronic
1130980069 15:88806259-88806281 TGGGGTTTGTGACCCACAAGGGG - Intronic
1135652193 16:24216154-24216176 CGGGGGCTGTGGCCCATTCAGGG + Exonic
1135721457 16:24821815-24821837 GGAGGGCAGTGAGCCACAAAAGG - Intronic
1136141544 16:28292231-28292253 CGTGGGCTCTGACCTAGAAAAGG + Intergenic
1140530209 16:75659363-75659385 CGGAGGCTGAGGCACACAAATGG - Intronic
1141428229 16:83957242-83957264 CGAGGACTGTGGCCCACAGAAGG + Intronic
1141785178 16:86194920-86194942 CGGGGGCTGTGGTCCACAGTGGG + Intergenic
1144653462 17:17021099-17021121 AGGAGCCTGTGACCCAGAAATGG + Intergenic
1145868531 17:28255933-28255955 CAATGGATGTGACCCACAAAGGG + Intergenic
1147580252 17:41623904-41623926 AGGGGGATGTGAGCCACACAGGG + Intronic
1151354123 17:73548517-73548539 CGGTTTCTGTGTCCCACAAATGG - Intronic
1152101619 17:78304929-78304951 CCGGGGCTGAGAGCCACAAGAGG - Intergenic
1152128515 17:78461780-78461802 CGAGGGCTGGGAGCCACAGAGGG + Intronic
1165058917 19:33195345-33195367 TGGGGGCTGAGAGACACAAAGGG - Intronic
1166408834 19:42542854-42542876 TGGGGGTTGTGTCCCACAGATGG + Intronic
928387513 2:30883108-30883130 CCATGGCTGTGACACACAAAAGG - Intergenic
932497091 2:72151158-72151180 CTGGGGCTGTGATCCCCACACGG - Intergenic
934039432 2:88115751-88115773 AAAGGGCTGTGACCTACAAAGGG - Intergenic
936608428 2:113979362-113979384 CGGGGGCGGTGACCCCCATCCGG - Intergenic
937959890 2:127449588-127449610 CAGGGGCTGTGACCAACACAAGG + Intronic
943044118 2:182838152-182838174 AGGGGTCTGTGACTTACAAATGG - Intronic
946399237 2:219460058-219460080 CGGGGGCTGCCTCCCCCAAATGG - Intronic
947782405 2:232780491-232780513 AGGTGTCTGTGACCCTCAAAAGG - Intronic
948730585 2:239961401-239961423 CTAGGGCTGGGAGCCACAAATGG + Intronic
1169906130 20:10606011-10606033 GGAGGGCTATGGCCCACAAAGGG - Intronic
1171186555 20:23127598-23127620 CAGGGGCTGTGGGCCACTAAGGG + Intergenic
1175216952 20:57396313-57396335 CGGTGGCCGTGGCCCACCAAGGG + Intronic
1175746352 20:61459883-61459905 CAGAGCCTGTGACCCACAGAAGG + Intronic
1177915384 21:27082637-27082659 CAGGGCCTGTGACCTACAGATGG + Intergenic
1179988580 21:44934050-44934072 CGGAGACTGTACCCCACAAAAGG + Intronic
1180597422 22:16987916-16987938 TGGGGGCAGTGACCCCCACAAGG - Intronic
1180997371 22:19972164-19972186 CAGGGGCTCTGACCCACAAGTGG - Intronic
1181069158 22:20321577-20321599 TGGGGGCTGTGAGCCACAGCAGG + Intergenic
1181743262 22:24938201-24938223 CTTGGGCTGTGGCCCCCAAAGGG - Exonic
1183982960 22:41553279-41553301 GGGTGGCTGGGACCCAAAAATGG - Intergenic
1185291156 22:50028503-50028525 CAGGGGCTGGGACCCACTCACGG - Intronic
1203280608 22_KI270734v1_random:128969-128991 TGGGGGCTGTGAGCCACAGCAGG - Intergenic
949388935 3:3537545-3537567 CGGGGCCTGTTGCCCACACATGG - Intergenic
950559946 3:13715497-13715519 CTGGGGTTGGGACACACAAAGGG + Intergenic
950657315 3:14444728-14444750 AGGGGCCTGAGACCTACAAAAGG - Intronic
950967519 3:17156328-17156350 GAGGGGCTGTGCCCCACAAGAGG + Intergenic
954575551 3:51674148-51674170 TGGGTGCTCTGACCCAGAAAGGG - Intronic
955912035 3:63867137-63867159 GGGGGTCTGTGACCCTCCAAGGG + Intronic
957079052 3:75621833-75621855 CCGGGGCTGGGACCCATACAGGG - Intergenic
958029734 3:88093859-88093881 CGGGGGCTGGGCCCCACAAAAGG + Intronic
958471204 3:94523157-94523179 AGTCTGCTGTGACCCACAAAGGG + Intergenic
961465202 3:127077141-127077163 TGGGGGCTGGGACCCAGGAATGG + Intergenic
964033424 3:152166686-152166708 AGGGTGGTGTTACCCACAAAGGG - Intergenic
964705482 3:159614474-159614496 AGGCAGCTGTGACCCACACACGG - Intronic
965097013 3:164242981-164243003 CTGGAGCTGTGATCCTCAAAGGG - Intergenic
968953309 4:3705866-3705888 TGGGGGCTGTGGCTTACAAAAGG - Intergenic
969359915 4:6657042-6657064 CCTGGTCTGTGGCCCACAAACGG - Intergenic
969861726 4:10041191-10041213 CAGGGGCTGACACCCCCAAAGGG - Intronic
970164539 4:13222480-13222502 CTGGGTCTGTGACCTAAAAATGG - Intergenic
985271647 4:188199038-188199060 TGGAGGCTGTGAGCCTCAAAAGG - Intergenic
986800604 5:11256283-11256305 AGAGTGGTGTGACCCACAAATGG - Intronic
990729464 5:58792553-58792575 CGGAAGCTGTGAACCACACATGG + Intronic
1003245070 6:4376359-4376381 CAGGGGCTGTGGTCCACAAAGGG + Intergenic
1004021360 6:11778809-11778831 CTTAGGCTGTGACCCACAGAAGG - Intronic
1006404698 6:33838154-33838176 AGGGGGCTGTGACACAGACAGGG + Intergenic
1008895979 6:56555697-56555719 TGGCAGCTGTGACCCAAAAATGG - Exonic
1013274215 6:108568650-108568672 CTGGGGCTGTGACTCTGAAAGGG + Intronic
1016319087 6:142822627-142822649 CTGGGGCTCTTAACCACAAATGG - Intronic
1018228307 6:161651835-161651857 CCTGAGCTGGGACCCACAAATGG + Intronic
1023094092 7:36642536-36642558 TGGGGGCTGTGACCACCAACTGG - Intronic
1023875092 7:44282500-44282522 CGTGGGCTGGGACACACACATGG + Intronic
1026364210 7:69631214-69631236 AGGGGTCAGTGACCCATAAAAGG + Intronic
1029463330 7:100709242-100709264 AAGAAGCTGTGACCCACAAATGG - Intergenic
1030115171 7:106057397-106057419 AGGGGTCTATGACCCAAAAAAGG + Intergenic
1032064066 7:128751352-128751374 CTGGGCCTGTGATCCCCAAAAGG - Intronic
1032764130 7:134974911-134974933 CTGGGGGTGTTACCCACACAGGG + Intergenic
1034887628 7:154810183-154810205 AGGGAGCTGTGACCTCCAAAGGG - Intronic
1038438854 8:27558050-27558072 CAGGGGCTGTGGCCAACACAAGG - Intergenic
1039639477 8:39204021-39204043 CGGGTCCGGTTACCCACAAAGGG - Intronic
1042067771 8:64897746-64897768 CTGGGGCAGTGACCTATAAATGG - Intergenic
1047913274 8:129554332-129554354 AGGGGACTGAGACCCACAATGGG - Intergenic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1049181293 8:141223859-141223881 TGGGACCTGTGACCCACAGAGGG + Intronic
1049453954 8:142677636-142677658 CAGGGGCTGTCAGCCACACACGG + Intronic
1057708358 9:97413732-97413754 CGGAGGCTGTGTGCCACCAAAGG - Intronic
1058713022 9:107697459-107697481 TGGGGTCTCTGACCCACATATGG - Intergenic
1060851727 9:126882833-126882855 TGGGGGCTATTACACACAAAGGG - Exonic
1061037440 9:128121475-128121497 CAGGGTCTGTGGCCCAGAAAAGG - Intronic
1061113412 9:128591774-128591796 AGGGGTCTGAGACCCACACAGGG - Intronic
1062099994 9:134723069-134723091 CGGGGGCTGTGACCCACAAAGGG - Intronic
1062617649 9:137405228-137405250 AGTGGGCTCTGACCCACAGAGGG + Intronic
1186521919 X:10213765-10213787 CGGCGGCTGTGACCAGCAAGTGG + Exonic
1189172701 X:38925046-38925068 AAGGGTCTGTGACCCCCAAAGGG + Intergenic
1190852806 X:54263121-54263143 CTGGGGCTGAGAACCACTAATGG - Intronic
1197706990 X:129641166-129641188 AGGAGGCTGAGACCCAGAAAGGG + Intergenic
1201727666 Y:17171268-17171290 TGGGGGCTGTGAACCAGAGAGGG - Intergenic