ID: 1062100381

View in Genome Browser
Species Human (GRCh38)
Location 9:134724933-134724955
Sequence TGCCATCCTCCAGATGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062100373_1062100381 19 Left 1062100373 9:134724891-134724913 CCAGGCTCGGGTGAACCAGGCTC 0: 2
1: 1
2: 0
3: 5
4: 126
Right 1062100381 9:134724933-134724955 TGCCATCCTCCAGATGGGGTTGG No data
1062100376_1062100381 4 Left 1062100376 9:134724906-134724928 CCAGGCTCGGATGAACCGTGGAG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1062100381 9:134724933-134724955 TGCCATCCTCCAGATGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062100381 Original CRISPR TGCCATCCTCCAGATGGGGT TGG Intronic
No off target data available for this crispr