ID: 1062103130

View in Genome Browser
Species Human (GRCh38)
Location 9:134738669-134738691
Sequence TTGGTTGGCCAGTTGGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 129}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062103121_1062103130 -6 Left 1062103121 9:134738652-134738674 CCACCCCCACCTCTGCCTTGGTT 0: 1
1: 0
2: 2
3: 69
4: 653
Right 1062103130 9:134738669-134738691 TTGGTTGGCCAGTTGGAACTTGG 0: 1
1: 0
2: 1
3: 5
4: 129
1062103117_1062103130 13 Left 1062103117 9:134738633-134738655 CCTGGGAGCCGGCGCTATCCCAC 0: 1
1: 0
2: 0
3: 7
4: 60
Right 1062103130 9:134738669-134738691 TTGGTTGGCCAGTTGGAACTTGG 0: 1
1: 0
2: 1
3: 5
4: 129
1062103115_1062103130 15 Left 1062103115 9:134738631-134738653 CCCCTGGGAGCCGGCGCTATCCC 0: 1
1: 0
2: 1
3: 2
4: 79
Right 1062103130 9:134738669-134738691 TTGGTTGGCCAGTTGGAACTTGG 0: 1
1: 0
2: 1
3: 5
4: 129
1062103118_1062103130 5 Left 1062103118 9:134738641-134738663 CCGGCGCTATCCCACCCCCACCT 0: 1
1: 0
2: 5
3: 41
4: 492
Right 1062103130 9:134738669-134738691 TTGGTTGGCCAGTTGGAACTTGG 0: 1
1: 0
2: 1
3: 5
4: 129
1062103123_1062103130 -9 Left 1062103123 9:134738655-134738677 CCCCCACCTCTGCCTTGGTTGGC 0: 1
1: 0
2: 0
3: 31
4: 273
Right 1062103130 9:134738669-134738691 TTGGTTGGCCAGTTGGAACTTGG 0: 1
1: 0
2: 1
3: 5
4: 129
1062103124_1062103130 -10 Left 1062103124 9:134738656-134738678 CCCCACCTCTGCCTTGGTTGGCC 0: 1
1: 0
2: 1
3: 39
4: 246
Right 1062103130 9:134738669-134738691 TTGGTTGGCCAGTTGGAACTTGG 0: 1
1: 0
2: 1
3: 5
4: 129
1062103113_1062103130 29 Left 1062103113 9:134738617-134738639 CCGCTTTTGCAGATCCCCTGGGA 0: 1
1: 0
2: 1
3: 17
4: 159
Right 1062103130 9:134738669-134738691 TTGGTTGGCCAGTTGGAACTTGG 0: 1
1: 0
2: 1
3: 5
4: 129
1062103116_1062103130 14 Left 1062103116 9:134738632-134738654 CCCTGGGAGCCGGCGCTATCCCA 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1062103130 9:134738669-134738691 TTGGTTGGCCAGTTGGAACTTGG 0: 1
1: 0
2: 1
3: 5
4: 129
1062103120_1062103130 -5 Left 1062103120 9:134738651-134738673 CCCACCCCCACCTCTGCCTTGGT 0: 1
1: 0
2: 4
3: 72
4: 608
Right 1062103130 9:134738669-134738691 TTGGTTGGCCAGTTGGAACTTGG 0: 1
1: 0
2: 1
3: 5
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062103130 Original CRISPR TTGGTTGGCCAGTTGGAACT TGG Intronic
901174884 1:7291713-7291735 GTGGGTGGCCAGTGAGAACTGGG + Intronic
905746982 1:40426492-40426514 CTGGTTGACCAGCTGGAAATTGG + Intergenic
908101559 1:60796458-60796480 TTGGTTGAAGAGTTGGAAGTTGG - Intergenic
909403309 1:75258402-75258424 GTCGTTGGGAAGTTGGAACTGGG + Intronic
910184328 1:84520398-84520420 TAAGTTGGCCACTTGGCACTTGG - Intergenic
910289736 1:85588530-85588552 GTGGTTGGCAAGCTAGAACTTGG - Intergenic
910586923 1:88890972-88890994 TTGGTAAGCCAGATGGAACCTGG - Intronic
912068284 1:105775130-105775152 TTGGTTGGCCAGAAGGCAGTGGG + Intergenic
913102926 1:115585979-115586001 TAGGTGGGCCAGCTGGAAGTGGG + Intergenic
913130613 1:115835197-115835219 TGTGTTGGTCAGTTGGAAGTTGG + Intergenic
913419981 1:118655192-118655214 TTGGTTAGGCAATTGGAAGTTGG + Intergenic
916748789 1:167705267-167705289 CTGGTTGGCCAGTTCAAATTTGG - Exonic
917736940 1:177929989-177930011 TTGATTGGACAGATGGAGCTAGG + Intronic
918218111 1:182410731-182410753 TAGGTTGGCCAGTTGAAACCTGG + Intergenic
919692192 1:200537850-200537872 TTGGGAGGCCAGTGGGAACATGG - Intergenic
922900536 1:229133136-229133158 TTGGTTGGTCAGTCAGAAGTAGG + Intergenic
923324160 1:232866089-232866111 TTAGTTGGCCAATTGGAAAGTGG - Intergenic
1063272335 10:4524498-4524520 TTGGTTGGCCCTTTGGAAGTGGG + Intergenic
1066477286 10:35760196-35760218 TGGGTTGGTCAGGAGGAACTGGG + Intergenic
1067231959 10:44418283-44418305 TTGGTTTCCCAGTTGGATATTGG + Intergenic
1067372652 10:45699631-45699653 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067387126 10:45826493-45826515 TAAGTGGGCCAGTTTGAACTTGG - Exonic
1067419001 10:46130758-46130780 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067447147 10:46358114-46358136 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067504354 10:46837347-46837369 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067590232 10:47502646-47502668 TAAGTGGGCCAGTTTGAACTTGG - Exonic
1067637352 10:48010748-48010770 TAAGTGGGCCAGTTTGAACTTGG - Intergenic
1067876135 10:50009586-50009608 TAAGTGGGCCAGTTTGAACTTGG + Exonic
1069040118 10:63687156-63687178 TTGGTTGGGCAGTGGGCAGTGGG - Intergenic
1070133950 10:73675177-73675199 TAAGTGGGCCAGTTTGAACTTGG - Exonic
1070205492 10:74255301-74255323 GTGGTTGGTCAGTTGGCACCAGG + Intronic
1071607765 10:87009305-87009327 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1072034239 10:91549919-91549941 TTGGTTGGCATCTGGGAACTTGG + Intergenic
1072123124 10:92421155-92421177 GTGGTTGGCCACTTCGGACTCGG - Intergenic
1072989250 10:100175211-100175233 TTGGTTGGCACCTAGGAACTTGG + Intronic
1073921578 10:108466025-108466047 TTGGTTGGTCTGTTGGAATGTGG - Intergenic
1074857389 10:117483493-117483515 TTGGATGGCCAGTGGGGATTAGG + Intergenic
1077793889 11:5470549-5470571 TTGGAAGTCCAGTTGGAAATTGG - Intronic
1078577468 11:12514115-12514137 GTGGTGGGCCACTTGGAACAGGG - Intronic
1080100390 11:28453008-28453030 TAGGTTGGCCAGATGGAAAATGG - Intergenic
1080843837 11:36008649-36008671 TGGGCTGGCAAGTTGCAACTGGG + Intronic
1084098452 11:66929062-66929084 TTGGTTGACCTGTCGGTACTAGG - Intronic
1085028807 11:73257512-73257534 TTGGTTGGGCAGCTGGAATGTGG + Intergenic
1085235213 11:75009389-75009411 TTTGTTGGTCATCTGGAACTTGG - Exonic
1089400382 11:118160985-118161007 TGGGGTGTCCAGTGGGAACTGGG + Intergenic
1095727323 12:45468521-45468543 TTGCTTGCCCAGTTGGACTTCGG - Intergenic
1097058009 12:56261863-56261885 TTGGTAGGCCTGTTGGACCTTGG + Intergenic
1099767891 12:87012756-87012778 TTGGCTGGCATCTTGGAACTTGG + Intergenic
1100713510 12:97282226-97282248 TTCTTTGGCCAGTTGGAATCTGG - Intergenic
1100958849 12:99939881-99939903 TTAGCTGTCCATTTGGAACTAGG - Intronic
1101958672 12:109231995-109232017 TTGGCTGGCCTCTGGGAACTTGG - Intronic
1111496063 13:89052738-89052760 ATGGTTGGCAAGTTGGACTTTGG + Intergenic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1120932509 14:89863523-89863545 TTGGTTTGCCTGCTGGCACTAGG + Intronic
1121149842 14:91622687-91622709 TTCGTTGGTCGGTTTGAACTGGG - Intronic
1122946966 14:105015966-105015988 TGGGGTGGCCAGTTAGAAGTGGG - Intronic
1125675275 15:41498875-41498897 CTGCTGGGGCAGTTGGAACTTGG + Intronic
1131277118 15:90991467-90991489 TTATTTGGCCTGTTGGAAATGGG + Intronic
1131991806 15:98100272-98100294 TTTGTGGGCCAGTTGGAATTTGG - Intergenic
1132468425 16:88668-88690 TAGGTTGACCCGTTGGGACTGGG - Intronic
1134222577 16:12366567-12366589 GTGGGAGGCCAGTTGGACCTGGG - Intronic
1134234553 16:12455232-12455254 TTGGGTGGCAAGTTAGAGCTTGG + Intronic
1135324012 16:21514431-21514453 CTGGATGGCCATATGGAACTTGG - Intergenic
1137859876 16:51835814-51835836 TTGGTTGTACAGTTGTAAATTGG + Intergenic
1138642971 16:58400562-58400584 TTGGTTGGCATTTGGGAACTTGG - Intronic
1140114514 16:72029979-72030001 GTGGTTGGTCAGTTGGGACCTGG + Intergenic
1140529429 16:75650873-75650895 TTGGCAAGCCATTTGGAACTTGG + Intronic
1142036220 16:87863537-87863559 CTGGATGGCCATATGGAACTTGG - Intronic
1143494964 17:7307598-7307620 TTGGTTGGTCAGTGGGGAGTCGG + Intronic
1144175716 17:12705158-12705180 TTGGTTAGCCAGTTGTTCCTGGG - Exonic
1146136503 17:30325975-30325997 ATGGTTGGAGAGTGGGAACTAGG + Intronic
1147368804 17:39977191-39977213 ATGGTTGGGCAGGTGGAAGTTGG - Exonic
1155282253 18:24251381-24251403 TTGCTCGGCCACCTGGAACTGGG - Intronic
1155490270 18:26394345-26394367 TTGTTTCACCAGTTGGAAGTTGG + Intergenic
1159459893 18:68711773-68711795 TTGGTTGGCATCTGGGAACTTGG + Intronic
1160438629 18:78871003-78871025 TTGGTTGGCCCTTTGTAAATTGG - Intergenic
1160502689 18:79410201-79410223 CTTGTTGGCCAGGTGGGACTGGG + Intronic
1165525988 19:36355125-36355147 TTGAGTGCCTAGTTGGAACTAGG - Intronic
1165652749 19:37505763-37505785 TAGGATGACCAGTTGGAATTAGG + Intergenic
1166181821 19:41114178-41114200 TTGCTTTGCCAGTTGGAGCCTGG - Intergenic
926437843 2:12855819-12855841 TTGGTTTGGCAGCTTGAACTGGG - Intergenic
937010712 2:118560432-118560454 TTGGTTGGGCAGAAGGAAGTAGG + Intergenic
937470379 2:122169260-122169282 TTGGCTGGCATGTGGGAACTTGG + Intergenic
937487050 2:122326221-122326243 TTTGTTGTCTAGTTTGAACTAGG - Intergenic
944525382 2:200613654-200613676 ATGGTGGGCCAATTTGAACTCGG + Intronic
947693127 2:232158243-232158265 ATGGAGGGTCAGTTGGAACTAGG + Intronic
1174284932 20:49465752-49465774 TTGAATGGCCAGTTTGGACTTGG - Intronic
1174589328 20:51632701-51632723 TTGGTTGGGTTGGTGGAACTGGG - Intronic
1175638042 20:60602111-60602133 TTGGTTAGCTAGATGGAGCTGGG - Intergenic
1180258707 21:46651420-46651442 TTGGTTGGGCAGTGGGGACATGG + Intronic
949722965 3:7012099-7012121 TTGGTTTTCTAGTTGGTACTTGG + Intronic
951722316 3:25713414-25713436 TTGGCTGGGCAGTTGTGACTTGG + Intergenic
953407115 3:42664988-42665010 GGGGTTGGCCAGTTGGAGCCTGG + Exonic
954274990 3:49536181-49536203 TTGGTTGGCCTGTAGGTTCTGGG + Intergenic
954783052 3:53074421-53074443 TTGGCTGGTCAGGTGGACCTTGG + Intronic
955025206 3:55160824-55160846 TTTCTTGGCCAGTTGGAATGTGG + Intergenic
961746669 3:129068320-129068342 TTGGGTGGTCAATGGGAACTGGG + Intergenic
962204320 3:133422638-133422660 TTGGTTGGCTGGCTGGAAATGGG + Intronic
962333913 3:134508222-134508244 TTGGTTGGCCATTTGCAACTTGG + Intronic
965474971 3:169146293-169146315 TTACTTGGCAAGGTGGAACTCGG + Exonic
967133183 3:186491463-186491485 TTGGGTGGCTACTTGGAACACGG - Intergenic
970523805 4:16911709-16911731 TTGGTTGGTTGGTTGGAACATGG + Intergenic
977531452 4:98205097-98205119 TTCGGTGGCCAGTAGGAAGTTGG + Intergenic
978779734 4:112538134-112538156 TCTGTTGGCCAGCTGGAGCTAGG - Intergenic
979419408 4:120485684-120485706 TTAGATGCCCAGTTGGAAGTTGG + Intergenic
982335993 4:154238872-154238894 TTGGTTGGACGGATGCAACTGGG + Intronic
983007283 4:162499542-162499564 TTTGTTGTCCTGTTGGCACTGGG - Intergenic
983254554 4:165383142-165383164 TTTGTGGCCCATTTGGAACTGGG + Intronic
985504838 5:272774-272796 TGAGTGGGCCAGTGGGAACTGGG + Intronic
985743276 5:1632821-1632843 TGAGTGGGCCAGTGGGAACTGGG - Intergenic
987176222 5:15313343-15313365 TTGGTTGGCTAATTGAAACATGG + Intergenic
992620537 5:78588011-78588033 TTTCTTGGCCACTTGGAACCAGG - Intronic
993252032 5:85539815-85539837 TTTTCTGGCTAGTTGGAACTGGG + Intergenic
994203019 5:97000405-97000427 TTGGGTGGCATGTGGGAACTTGG + Intronic
998792520 5:145780260-145780282 TTTGTTGCCCAGCTGGATCTTGG - Intronic
1014186848 6:118444887-118444909 TTGCTGAGCCATTTGGAACTAGG + Intergenic
1015784411 6:136906221-136906243 TTGTGTGGCCAGTTAGAAATAGG + Intronic
1017933300 6:158979736-158979758 TTTGTTGGCCAGTAGTATCTTGG - Intronic
1028931657 7:96419891-96419913 GTGCTGGGCCACTTGGAACTAGG - Intergenic
1031178517 7:118383984-118384006 TTGGTTTACCAGTTGGGAATGGG + Intergenic
1033011310 7:137625524-137625546 TTGGTTGGCATCTGGGAACTCGG + Intronic
1033620325 7:143056734-143056756 TGGGTTAGCCATTTAGAACTAGG - Intergenic
1034834521 7:154339341-154339363 TAGTTTGGCCAGTGGGAACGCGG + Intronic
1039783926 8:40815728-40815750 GAGGTTTTCCAGTTGGAACTTGG - Intronic
1041776402 8:61527826-61527848 TTGGTTGGCTTGTTGGTGCTAGG + Intronic
1042963232 8:74324258-74324280 TTGGTTTGACAGGTGGAACGGGG + Intronic
1048133545 8:131723390-131723412 TTGGTTGACATCTTGGAACTTGG - Intergenic
1051139373 9:13962094-13962116 TTGGCTGGCCTGTTGGCAATGGG - Intergenic
1052525723 9:29616337-29616359 ATGGTTGGCCATTAGGAACTTGG + Intergenic
1053541510 9:38978756-38978778 TTGCTCGGCCACTTGGAAATGGG + Intergenic
1053805929 9:41801800-41801822 TTGCTCGGCCACTTGGAAATGGG + Intergenic
1054624629 9:67385150-67385172 TTGCTCGGCCACTTGGAAATGGG - Intergenic
1060328804 9:122644607-122644629 TTGCTGAGCCACTTGGAACTGGG - Intergenic
1062103130 9:134738669-134738691 TTGGTTGGCCAGTTGGAACTTGG + Intronic
1190098816 X:47504515-47504537 TTGGCTGGCAATTAGGAACTTGG + Intergenic
1198978908 X:142371009-142371031 CTTGTTGGCCAGTTGGATATGGG - Intergenic