ID: 1062103550

View in Genome Browser
Species Human (GRCh38)
Location 9:134740584-134740606
Sequence CTGGATGGATAGAAGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1586
Summary {0: 1, 1: 0, 2: 15, 3: 181, 4: 1389}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062103550_1062103556 7 Left 1062103550 9:134740584-134740606 CCGTCCTCCTTCTATCCATCCAG 0: 1
1: 0
2: 15
3: 181
4: 1389
Right 1062103556 9:134740614-134740636 ATTTGTACTGAGTGCCTGCAGGG No data
1062103550_1062103555 6 Left 1062103550 9:134740584-134740606 CCGTCCTCCTTCTATCCATCCAG 0: 1
1: 0
2: 15
3: 181
4: 1389
Right 1062103555 9:134740613-134740635 GATTTGTACTGAGTGCCTGCAGG No data
1062103550_1062103562 30 Left 1062103550 9:134740584-134740606 CCGTCCTCCTTCTATCCATCCAG 0: 1
1: 0
2: 15
3: 181
4: 1389
Right 1062103562 9:134740637-134740659 CTGGGCACTGCTCTAGCCTGGGG No data
1062103550_1062103558 12 Left 1062103550 9:134740584-134740606 CCGTCCTCCTTCTATCCATCCAG 0: 1
1: 0
2: 15
3: 181
4: 1389
Right 1062103558 9:134740619-134740641 TACTGAGTGCCTGCAGGGCTGGG No data
1062103550_1062103557 11 Left 1062103550 9:134740584-134740606 CCGTCCTCCTTCTATCCATCCAG 0: 1
1: 0
2: 15
3: 181
4: 1389
Right 1062103557 9:134740618-134740640 GTACTGAGTGCCTGCAGGGCTGG No data
1062103550_1062103561 29 Left 1062103550 9:134740584-134740606 CCGTCCTCCTTCTATCCATCCAG 0: 1
1: 0
2: 15
3: 181
4: 1389
Right 1062103561 9:134740636-134740658 GCTGGGCACTGCTCTAGCCTGGG No data
1062103550_1062103560 28 Left 1062103550 9:134740584-134740606 CCGTCCTCCTTCTATCCATCCAG 0: 1
1: 0
2: 15
3: 181
4: 1389
Right 1062103560 9:134740635-134740657 GGCTGGGCACTGCTCTAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062103550 Original CRISPR CTGGATGGATAGAAGGAGGA CGG (reversed) Intronic
900485707 1:2921692-2921714 CTGGATGGACAGATGGACGGAGG - Intergenic
900485716 1:2921734-2921756 CTGGATGGACAGATGGACGGAGG - Intergenic
900485725 1:2921776-2921798 CTGGATGGACAGATGGACGGAGG - Intergenic
900485735 1:2921818-2921840 CTGGATGGACAGATGGACGGAGG - Intergenic
900485744 1:2921860-2921882 CTGGATGGACAGATGGACGGAGG - Intergenic
900498729 1:2989278-2989300 ATGAATGGATGGATGGAGGATGG - Intergenic
900498748 1:2989373-2989395 GAGGATGAATAGATGGAGGATGG - Intergenic
900498766 1:2989463-2989485 ATGGATGGATGGATGGATGATGG - Intergenic
900498784 1:2989543-2989565 ATGGATGAATGGATGGAGGATGG - Intergenic
900509425 1:3051531-3051553 ATGGATGGATGGATGGATGATGG - Intergenic
900509591 1:3052242-3052264 ATGGATGGATAGAGGTTGGAAGG - Intergenic
900569540 1:3351567-3351589 AGGGAGGGAGAGAAGGAGGAAGG - Intronic
900573330 1:3370817-3370839 ATGGATGAATAGATGGTGGATGG - Intronic
900573469 1:3371461-3371483 ATGGATGGATAGATGGTGGATGG - Intronic
900573486 1:3371516-3371538 ATGGATGGATAGATGGTGGATGG - Intronic
900681985 1:3921612-3921634 GTGAAAGGATAGAAGGATGATGG + Intergenic
900892300 1:5458339-5458361 AAGGAGGGAGAGAAGGAGGAAGG - Intergenic
900918548 1:5656138-5656160 AGGGATGGAGAGAAAGAGGAAGG + Intergenic
900922004 1:5678790-5678812 ATGGATGGATGGATGGATGAGGG + Intergenic
900931020 1:5737659-5737681 ATGGATGGATGGATGGATGATGG + Intergenic
900931074 1:5738052-5738074 ATGGATGGATGGACGGTGGATGG + Intergenic
901001369 1:6150510-6150532 ATGGATGGATGGATGGTGGATGG + Intronic
901006632 1:6174885-6174907 ATGGATGGATAGATGGTGGGTGG + Intronic
901646008 1:10717072-10717094 CTGGAGGGACAGGAGCAGGAGGG + Intronic
901699871 1:11039580-11039602 CTGGAAGGATGGATGGATGATGG + Intronic
901863729 1:12090433-12090455 ATGGATGGATGGATGGGGGAAGG - Intronic
901928808 1:12583816-12583838 ATGGTTGGATAGATGGAGTAGGG - Intronic
902255385 1:15185868-15185890 CAGCATGGATAATAGGAGGATGG - Intronic
902261431 1:15227655-15227677 ATGGATGGAGAAAAGGAGAAAGG - Intergenic
902400046 1:16152637-16152659 CTGGGTGGGTAGAAGGACAAAGG + Intronic
902412856 1:16221587-16221609 ATGGATGGATGGATGGATGATGG + Intergenic
902412888 1:16221777-16221799 ATGGATGGATGAATGGAGGATGG + Intergenic
902479067 1:16702225-16702247 CTGGAAGGAGGGAGGGAGGAAGG - Intergenic
902614523 1:17616531-17616553 GTGGATGGATAAAGGAAGGAGGG - Intronic
902628584 1:17691101-17691123 CTGTCTGGTTAAAAGGAGGAGGG - Intronic
902671981 1:17980843-17980865 GTGGATGGATAAAAGGATGGAGG - Intergenic
902721222 1:18305471-18305493 ATGGATGGATGGATGGATGATGG + Intronic
902721244 1:18305579-18305601 ATGGATGGATGGATGGATGATGG + Intronic
902722839 1:18315577-18315599 GTGGATGGGTAGAGGGTGGATGG + Intronic
903175173 1:21576236-21576258 ATGGATGGATGGATGGATGATGG + Intronic
903224410 1:21886711-21886733 ATGGGTGGATAGATGGATGAAGG + Intronic
903331723 1:22600093-22600115 GAGGAAGGAGAGAAGGAGGAAGG + Intronic
903331766 1:22600238-22600260 AAGGAAGGACAGAAGGAGGAAGG + Intronic
903341677 1:22658796-22658818 ATGGATGGATGGATGGAGGGTGG + Intronic
903341678 1:22658800-22658822 ATGGATGGATGGAGGGTGGATGG + Intronic
903421126 1:23218201-23218223 CTGGATGAATGGAAGGGGGCGGG + Intergenic
903565977 1:24266178-24266200 ATGGATGGATAGAGGGAGGGTGG + Intergenic
903670297 1:25031353-25031375 CTGGAGGGATAGAAGGATGGCGG + Intergenic
903674231 1:25054351-25054373 ATGGATGGAAGGAAGGAGAAAGG - Intergenic
903690428 1:25169326-25169348 ATGGATGGATGGATGGATGATGG + Intergenic
904464524 1:30699979-30700001 ATGGATGGATGGATGGATGAAGG - Intergenic
904464546 1:30700086-30700108 ATGGATGGATAGGTGGTGGAGGG - Intergenic
904465112 1:30702955-30702977 ATGGATGGATGGATGGATGATGG + Intergenic
904581357 1:31546517-31546539 ATGGATGGATGGATGGATGATGG - Intergenic
904605219 1:31694500-31694522 CTGGATTGAAAGAGGGAGCAGGG + Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905274627 1:36809197-36809219 ATGGATGGATGGATGGATGATGG - Intronic
905337679 1:37256720-37256742 AGAGATGGAGAGAAGGAGGATGG - Intergenic
905529235 1:38663451-38663473 TAGGATGGATAGCAGGGGGAAGG + Intergenic
905885505 1:41489686-41489708 ATGGATAGAAAGAAGGTGGATGG - Intergenic
905885551 1:41489884-41489906 ATGGATAGAAAGAAGGTGGATGG - Intergenic
905891252 1:41519845-41519867 ATGGAAGGATAGATGGAGAATGG + Intronic
906180686 1:43815915-43815937 ATGGATGGATGGATGGATGATGG + Intronic
906493370 1:46285577-46285599 GTGGCTGGCGAGAAGGAGGATGG - Exonic
906529221 1:46513612-46513634 CTGGATGGAGAGCAGCAGCAGGG + Exonic
906730827 1:48079708-48079730 CTGAAAGGATAGCAGGAGAAAGG - Intergenic
906800798 1:48735375-48735397 ATGGATGGATGGAGGGAGGGTGG + Intronic
906860334 1:49352526-49352548 CTGGAAGGCCAGAAGGAGGGGGG - Intronic
907122522 1:52019829-52019851 ATGGATCGATTGCAGGAGGAGGG + Intergenic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907264693 1:53250467-53250489 GAGGAAGGAAAGAAGGAGGAAGG + Intronic
907752565 1:57276955-57276977 GTGGAAGGAAAGAGGGAGGAAGG + Intronic
907864407 1:58385692-58385714 CAGGATGCAAAGCAGGAGGAAGG + Intronic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908391370 1:63686692-63686714 ATGGATGGATGGATGGATGAAGG - Intergenic
908437474 1:64120830-64120852 GTGGATGGATGGATGGAGAATGG + Intronic
908761532 1:67517205-67517227 CTAAATGGAAAGAAAGAGGAAGG + Intergenic
909162111 1:72165611-72165633 CTTGATGGATTGAATGAGAAGGG - Intronic
909288733 1:73854915-73854937 CGGGAGGGAGAGAGGGAGGAAGG + Intergenic
909573306 1:77142779-77142801 ATGTGTGGAGAGAAGGAGGAAGG - Intronic
910053859 1:83008473-83008495 GTGGAAGGAGAGAGGGAGGAAGG - Intergenic
910410385 1:86937251-86937273 CTGGAAGGAAGGAGGGAGGAAGG - Intronic
910964445 1:92794171-92794193 AAGGAAGGAGAGAAGGAGGAAGG + Intergenic
911184230 1:94887330-94887352 CTGAATGAATAGGGGGAGGAGGG - Intronic
911629816 1:100170680-100170702 ATGGAGGGAGGGAAGGAGGAAGG - Intronic
912654365 1:111472376-111472398 TTGGATGGATGGAGGGAGAAAGG - Intergenic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
913405421 1:118485732-118485754 CTGCATGGAGATAAGGAGGCAGG - Intergenic
914351392 1:146843111-146843133 ATGGATGGATAGATAGATGATGG + Intergenic
915347211 1:155203593-155203615 CTGGTTGGTGAGAAGGAGGAAGG + Intronic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
916004464 1:160646784-160646806 GTGGATGGAGAGAAGGTGCAGGG - Intronic
916879863 1:169010085-169010107 CTGCATGGATAGAAGAAGTGTGG + Intergenic
917135251 1:171782884-171782906 CTGGAGGTAGGGAAGGAGGAAGG + Intronic
918427312 1:184423854-184423876 ATGGATGGATGGATGGACGATGG - Intronic
918623516 1:186632448-186632470 CTGGATGGAACAAAGGAGCAGGG + Intergenic
919505477 1:198392982-198393004 CTGGAAGGAGAGAAGAAGGCAGG - Intergenic
919826995 1:201510182-201510204 ATGGATGGATGGATGGAGGGAGG - Intergenic
919922272 1:202173655-202173677 ATGGATGGATGGATGGTGGATGG - Intergenic
919935113 1:202246026-202246048 ATGGATGGATGGAGGGAGGGAGG - Intronic
920002823 1:202811232-202811254 TTGGATGGACCGAATGAGGATGG - Intergenic
922209789 1:223478543-223478565 TTTGATTGATAGGAGGAGGAAGG + Intergenic
922224418 1:223632929-223632951 CCAGATGGGAAGAAGGAGGAAGG - Intronic
922232162 1:223696795-223696817 GTGGATGGATAGACGGAGAGAGG - Intergenic
922309952 1:224379046-224379068 CTGAAAGGATAGAAGGAAAAAGG - Exonic
922648513 1:227317668-227317690 CAGAATGCATAGAAGGGGGAGGG + Exonic
922700128 1:227754432-227754454 ACGGATGGACAGATGGAGGAAGG - Intronic
922745561 1:228041496-228041518 ATTGATGGATAGATGGATGATGG - Intronic
922745707 1:228042385-228042407 CTGGATGGATGGATGGATGATGG + Intronic
922792933 1:228320339-228320361 ATGGATGGATAGATGGTGGATGG - Intronic
923152869 1:231249908-231249930 CTGGTTGGATAGAAGCTGAATGG + Intronic
923432711 1:233938638-233938660 ATGGATGGATGGAAGGATGGAGG + Intronic
923433934 1:233950598-233950620 GTGGAGGGATGGAGGGAGGAGGG - Intronic
923474988 1:234323728-234323750 ATGGAGGGATGGAAGGAGGGAGG + Exonic
924501027 1:244638200-244638222 CTGGATGGATCGGAGAAAGAGGG - Intronic
924678878 1:246210375-246210397 CTGGATGGATAAATGCATGAAGG + Intronic
1062773400 10:123639-123661 ATGGAGGGAAGGAAGGAGGAAGG + Intergenic
1062928356 10:1335252-1335274 AGGGATGGATAGAAGGATGGAGG + Intronic
1062940159 10:1414930-1414952 GTGGATGGATGGATGGTGGATGG + Intronic
1063112309 10:3047759-3047781 AGGGATGGATAGAGGGAGGGAGG - Intergenic
1063164303 10:3446032-3446054 ATGGATGCAAAGAAAGAGGAGGG + Intergenic
1063181520 10:3604843-3604865 GTTGATTGATAGAAAGAGGATGG - Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063473428 10:6307565-6307587 GGGGAGGGAGAGAAGGAGGAAGG - Intergenic
1063907041 10:10791947-10791969 AAGGAAGGAGAGAAGGAGGAAGG + Intergenic
1063958242 10:11284773-11284795 GTGGATGGATGGATGGTGGATGG + Intronic
1064132361 10:12721505-12721527 ATGGATGGATGGATGGTGGATGG - Intronic
1064294543 10:14066463-14066485 CTGGATAGAGAGAATGAGTAGGG + Intronic
1064896381 10:20241954-20241976 ATGGATGGATGGATGGAGAAAGG + Intronic
1065860679 10:29870336-29870358 ATGGATGGATGGATGGTGGATGG - Intergenic
1066106961 10:32164942-32164964 CAAGATGGAATGAAGGAGGATGG - Intergenic
1066229333 10:33416910-33416932 GTGGATGGATGGATGGATGATGG + Intergenic
1067342426 10:45416715-45416737 ATGGATGAAGGGAAGGAGGAAGG + Intronic
1067709622 10:48637580-48637602 ATGGATGGATAAATGGTGGATGG + Intronic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1067808236 10:49407907-49407929 GTGGGTGGATGGAAGGAGGAAGG + Intergenic
1068948651 10:62755312-62755334 TTGGTTGGATGGAAGAAGGATGG + Intergenic
1069601630 10:69711869-69711891 ATGGATGGATGGATGGATGATGG - Intergenic
1069788961 10:71007218-71007240 TTGGATGGGTAGATGGATGATGG - Intergenic
1070363624 10:75714822-75714844 AGGGAGGGAAAGAAGGAGGAAGG - Intronic
1070379586 10:75868773-75868795 CAGGATGGAGAGAGAGAGGAGGG - Intronic
1070749902 10:78957851-78957873 ATGGATGGATGGATGGATGAAGG + Intergenic
1071245655 10:83759641-83759663 CTAAATGGATAGAAAGAGAAAGG - Intergenic
1071468456 10:85961733-85961755 AAGGAAAGATAGAAGGAGGATGG - Intronic
1071468508 10:85962014-85962036 AAGGAAGGAAAGAAGGAGGAAGG + Intronic
1071508580 10:86247369-86247391 ATGGATGGATGGATGGATGATGG + Intronic
1071575553 10:86723319-86723341 ATGCATGGATAAATGGAGGAGGG + Intronic
1071622547 10:87134877-87134899 CTGGCTGGAGAGGAGGAGCAGGG + Intronic
1072945166 10:99803461-99803483 ATGGAAGGAGAGAGGGAGGAAGG - Intronic
1072945169 10:99803469-99803491 ATGGATGGATGGAAGGAGAGAGG - Intronic
1073323839 10:102631272-102631294 ATGAATGGATACAGGGAGGATGG - Exonic
1073467166 10:103700945-103700967 ATGGATGGATGGATGGATGATGG - Intronic
1073467170 10:103700964-103700986 ATGGATGGATGGATGGTGGATGG - Intronic
1073467179 10:103701013-103701035 ATGGATGGATGGATGGTGGATGG - Intronic
1073467185 10:103701036-103701058 ATGGATGGATGGATGGTGGATGG - Intronic
1073467191 10:103701059-103701081 ATGGATGGATGGATGGATGATGG - Intronic
1073467213 10:103701172-103701194 ATGGATGGATGGATGGTGGATGG - Intronic
1073467257 10:103701402-103701424 GTGGATGGATGGATGGTGGATGG - Intronic
1073467264 10:103701428-103701450 ATGAATGGATAGATGGTGGATGG - Intronic
1073467282 10:103701526-103701548 GTGGATGGATGGATGGTGGATGG - Intronic
1073467303 10:103701634-103701656 ATGGATGGATAGATGATGGATGG - Intronic
1073467364 10:103701979-103702001 ATGGATGGATGGATGGTGGATGG - Intronic
1073467377 10:103702035-103702057 GTGGATGGATAGATGGATGATGG - Intronic
1073467399 10:103702161-103702183 ATGGATGGATGGATGGTGGATGG - Intronic
1073662645 10:105493861-105493883 ATGGAGGGAAAGAAGAAGGAAGG + Intergenic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074896304 10:117780496-117780518 ATGGATGGATAGATGGATGGAGG - Intergenic
1075648258 10:124110487-124110509 ATGGATGGATGGATGGATGATGG + Intergenic
1075918297 10:126188783-126188805 ATGGATGGATGAAAGGATGATGG - Intronic
1076037526 10:127213023-127213045 GGGGATGGATAGAAAGGGGATGG - Intronic
1076122073 10:127944345-127944367 GTGGATGGATGGATGGACGATGG + Intronic
1076136725 10:128050242-128050264 ATGGATGGATGGATGGATGATGG + Intronic
1076371024 10:129953736-129953758 CTGGGTGGATGGAAGGTGCAAGG - Intronic
1076433792 10:130425866-130425888 GTGGATGGAGGGAAGGAGAAGGG + Intergenic
1076449686 10:130548372-130548394 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1076494436 10:130887636-130887658 ATGGATGGATGGATGGATGAAGG + Intergenic
1076825136 10:132963425-132963447 ATGGACGGATGGATGGAGGAAGG - Intergenic
1076844953 10:133065483-133065505 ATGGATGGATGGATGGTGGATGG + Intergenic
1076844985 10:133065582-133065604 GTGGATGGATGGATGGTGGATGG + Intergenic
1076845003 10:133065650-133065672 ATGGATGGATAGATGGAGGGTGG + Intergenic
1076845049 10:133065802-133065824 AGGGATGGATAGATGGTGGATGG + Intergenic
1076845054 10:133065817-133065839 GTGGATGGATGGAGGGTGGACGG + Intergenic
1076845121 10:133066046-133066068 ATGGGTGGATAGATGGTGGATGG + Intergenic
1076845126 10:133066061-133066083 GTGGATGGATGGAGGGTGGATGG + Intergenic
1076845186 10:133066247-133066269 GTGGATGGATGGATGGTGGATGG + Intergenic
1076867458 10:133175083-133175105 GTGGATGGATAGATGGATGGTGG + Intronic
1076931874 10:133536885-133536907 ATGGGTGGATGGATGGAGGATGG + Intronic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1077159495 11:1106246-1106268 GTGGATGGATGGATGGTGGATGG - Intergenic
1077159570 11:1106513-1106535 ATGGATGGATGGATGGTGGATGG - Intergenic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280507 11:1742914-1742936 ATGGATAGATGGATGGAGGATGG + Intronic
1077280511 11:1742933-1742955 ATGGATGGATAGATGGATGGAGG + Intronic
1077280512 11:1742937-1742959 ATGGATAGATGGATGGAGGATGG + Intronic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280527 11:1743014-1743036 ATGGATGGATTGAGGGTGGATGG + Intronic
1077280530 11:1743029-1743051 GTGGATGGATGGATGGATGAAGG + Intronic
1077280531 11:1743033-1743055 ATGGATGGATGGATGAAGGATGG + Intronic
1077280541 11:1743067-1743089 ATGGATGGATGGATGGAGGATGG + Intronic
1077280548 11:1743097-1743119 ATGGATGGATAGATGGATGGAGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077280588 11:1743339-1743361 ATGGATGGATGGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077304201 11:1861544-1861566 ATGGATGGATAGATGGATAATGG + Intronic
1077307153 11:1873543-1873565 AGGGAAGGATAGAGGGAGGAGGG + Intronic
1077310334 11:1885956-1885978 TTGGTTGGATAGAAGGATGTTGG - Intronic
1077312218 11:1893985-1894007 CGGGAAGGATGGATGGAGGAAGG + Intergenic
1077315021 11:1915739-1915761 GTGGATGGATGGATGGAGGGAGG + Intergenic
1077480881 11:2814000-2814022 ATGGATGGATGGATGGATGATGG + Intronic
1077761359 11:5103140-5103162 CTGGAAGGAAGGAAGAAGGAAGG + Intergenic
1078280157 11:9893168-9893190 CTGGCTGGACAGTATGAGGATGG + Intronic
1078682558 11:13491131-13491153 CTAGATGAAAAGAAGTAGGAGGG - Intergenic
1079252043 11:18793521-18793543 CTGCATGGAGAAAATGAGGAGGG - Intergenic
1079275013 11:19027266-19027288 CTGGATGGTTAGAATGGGGTAGG + Intergenic
1079964399 11:26963213-26963235 CAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1080156617 11:29118704-29118726 AAGGAAGGATGGAAGGAGGAAGG + Intergenic
1080415115 11:32062562-32062584 ATGGATGGATGGATGGTGGATGG + Intronic
1080466692 11:32504094-32504116 AAGGAAGGAAAGAAGGAGGAAGG + Intergenic
1080711983 11:34757643-34757665 CAGGATGGGTAGTAGGAGAATGG + Intergenic
1080754693 11:35185573-35185595 ATGGATGGAGAGAGGGAGGGAGG - Intronic
1080781489 11:35433828-35433850 ATGGATGGATGGATGGATGAGGG + Intronic
1080826923 11:35856311-35856333 TAGGATGGATGGAGGGAGGATGG + Intergenic
1081662405 11:44896114-44896136 CTGGGTGGATTGAGGGAGGAAGG + Intronic
1081678979 11:44988631-44988653 TTGGATGGATGGATGGACGATGG + Intergenic
1081706144 11:45182838-45182860 CTGGAGGGATGGAAAGAGAAGGG - Intronic
1081765814 11:45609398-45609420 ATGGATGGATAGGAAAAGGATGG + Intergenic
1082059851 11:47850478-47850500 CTGGAAAGAAGGAAGGAGGAAGG + Intergenic
1082781382 11:57290190-57290212 ATGGATGGATGGATGGATGAAGG + Intergenic
1083542170 11:63519598-63519620 CTGGAGGGAGAAAAGAAGGAAGG + Intergenic
1083622405 11:64055699-64055721 ATGGATGGATGGATGGATGATGG + Intronic
1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG + Exonic
1083879843 11:65542978-65543000 ATGGATGGATGGATGGATGAAGG + Intronic
1083879844 11:65542982-65543004 ATGGATGGATGGATGAAGGATGG + Intronic
1083879852 11:65543013-65543035 GTGGATGGATGGATGGAGAAAGG + Intronic
1084445076 11:69198908-69198930 GTGGATGGATAATAGGTGGATGG - Intergenic
1084543830 11:69803775-69803797 ATGGATGGATGGATGGATGATGG + Intergenic
1084543847 11:69803888-69803910 ATGGATGGATGGATGGATGATGG + Intergenic
1084543901 11:69804223-69804245 ATGGATGGATAGATGGATGATGG + Intergenic
1084576527 11:69992175-69992197 ATGGATGGATAGTAGGTGAATGG + Intergenic
1084576540 11:69992238-69992260 ATGGATGGATGGATGGATGATGG + Intergenic
1084579222 11:70012347-70012369 ATGGATGGATGGATGGATGAAGG - Intergenic
1084579265 11:70012688-70012710 ATGGATGGATGGATGGATGAAGG - Intergenic
1084609661 11:70194152-70194174 ATGGATGGATGGATGGTGGATGG + Intergenic
1084609760 11:70194630-70194652 ATGGATGGATGGATGGTGGATGG + Intergenic
1084609837 11:70195037-70195059 ATGGATGGATGGATGGTGGATGG + Intergenic
1084658813 11:70535409-70535431 ATGGATGGATGGATGGATGATGG - Intronic
1084667781 11:70585771-70585793 GTGGATGGATGGATAGAGGATGG - Intronic
1084667808 11:70585894-70585916 ATGGATGGATGGGGGGAGGATGG - Intronic
1084684617 11:70686310-70686332 ATGGATGGGTAGATGGATGATGG - Intronic
1084684637 11:70686405-70686427 ATGGATGGGTAGATGGATGATGG - Intronic
1084684657 11:70686496-70686518 ATGGATGGATAGACAGATGATGG - Intronic
1084697479 11:70764316-70764338 ATAGATGGATAGAAGGAGGAGGG - Intronic
1084705150 11:70811798-70811820 ATGGATGGGTAGATGGATGATGG - Intronic
1084713530 11:70859189-70859211 CTGGATGGATGGGTGGATGAGGG + Intronic
1084740004 11:71133410-71133432 ATGGATGGACAGATGGAGGGAGG + Intronic
1084781845 11:71414982-71415004 ATGGATGGGTAGATGGATGATGG + Intergenic
1085406834 11:76268536-76268558 ATGGATGGATGGATGGTGGAGGG - Intergenic
1085406867 11:76268657-76268679 ATGGATGGATGGATGGAGGATGG - Intergenic
1085406872 11:76268676-76268698 ATGGATGGATAGAGGATGGATGG - Intergenic
1085406873 11:76268680-76268702 ATGGATGGATGGATAGAGGATGG - Intergenic
1085406894 11:76268761-76268783 ATGAATGGATGGATGGAGGATGG - Intergenic
1085528583 11:77178329-77178351 GTGGATGGATGGATGGTGGATGG - Intronic
1085816064 11:79738796-79738818 GTGGAGGAAGAGAAGGAGGATGG + Intergenic
1086031845 11:82368715-82368737 GAGGAGGGATAGAAGAAGGAGGG + Intergenic
1086401979 11:86468335-86468357 ATGGATGGATGGATGGATGATGG - Intronic
1086616145 11:88822800-88822822 GGGGAGGGAGAGAAGGAGGAAGG - Intronic
1086782103 11:90920176-90920198 CTGGATGGACAGGAGCAGGTAGG + Intergenic
1087235850 11:95717909-95717931 CTGGGTGAATAGAAGGTAGATGG - Intergenic
1087270326 11:96104788-96104810 CTAGATTGAAAGAAGGAGAAGGG + Intronic
1087965337 11:104405957-104405979 TTGGATGGATAAAAGGGGAAAGG + Intergenic
1088709015 11:112489835-112489857 ATGGATGGATAGATGGATGATGG - Intergenic
1089560723 11:119341829-119341851 CTGGGTGGAGGGAAGGAGGGCGG - Intronic
1090024087 11:123152931-123152953 CTGGAGGGAGAGAAGGATGTTGG + Intronic
1090355945 11:126140437-126140459 CTGGGTGGAAAGGAGGAGTAAGG + Intergenic
1090730393 11:129568681-129568703 CTGGATGGACTGGAGGAAGAAGG + Intergenic
1090752775 11:129761986-129762008 CTGGATGGAGGTAAGGAGGCAGG + Intergenic
1090756509 11:129796385-129796407 CTGGATGGCTAGCACCAGGATGG + Intergenic
1090857096 11:130619709-130619731 ATGGATAGATGGATGGAGGATGG - Intergenic
1090857097 11:130619713-130619735 TTGGATGGATAGATGGATGGAGG - Intergenic
1091187304 11:133658294-133658316 ATGGATGGATGGATGGATGATGG + Intergenic
1091407333 12:217381-217403 ATGGATGGATGGATGGAGGATGG + Intergenic
1091755867 12:3051153-3051175 CTGAAAGGAAGGAAGGAGGAAGG - Intergenic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093175111 12:15904768-15904790 CTGGACGTAAAGAAAGAGGAAGG - Intergenic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1095240747 12:39856218-39856240 ATGCATGGATAGATGGATGAAGG - Intronic
1095288680 12:40448686-40448708 AAGGAAGGAAAGAAGGAGGAAGG - Intronic
1095722844 12:45419741-45419763 CTGGTTGGAAGGAAGGAGAAAGG - Intronic
1095947711 12:47763298-47763320 TGGGATGGAGAGAGGGAGGATGG + Intronic
1095970047 12:47895394-47895416 TGGGAGGGAGAGAAGGAGGAGGG + Intronic
1096197063 12:49655603-49655625 AAGGAGGGAAAGAAGGAGGAAGG + Intronic
1096523750 12:52198639-52198661 CTGGGTGGAGAGGAGCAGGAAGG + Intergenic
1096611227 12:52803312-52803334 ATGGATGAATAGATGGATGATGG + Intergenic
1097251981 12:57639599-57639621 CTGGATGGATGGATGGAGCCCGG + Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097946933 12:65379222-65379244 ATGGATGGGTAGATGGTGGATGG - Intronic
1098353005 12:69583398-69583420 TTGGATGGGGAGAAGGAGGCAGG - Intergenic
1098554124 12:71799299-71799321 CTGGAAGGGTTGAAGGAGCAGGG - Exonic
1099374895 12:81887041-81887063 ATAGATGGATAGATGGAAGAAGG + Intergenic
1100370702 12:93966697-93966719 AGGGATGGAAAGAGGGAGGAAGG - Intergenic
1100431487 12:94535233-94535255 GGGTATGGATAGAAGGGGGAAGG + Intergenic
1100765947 12:97865820-97865842 CTGGGGGGATAGATTGAGGAGGG - Intergenic
1101727091 12:107396796-107396818 CTGCCTGGAGGGAAGGAGGAAGG - Intronic
1102705694 12:114878421-114878443 ATGGAAGGAGAGAAGGAGGGAGG - Intergenic
1102856122 12:116295572-116295594 ATGGATGGATAGATGATGGATGG + Intergenic
1102895620 12:116595853-116595875 ATGGATGGATGGATGGATGAAGG + Intergenic
1102919996 12:116784766-116784788 GTGGAGATATAGAAGGAGGATGG - Intronic
1102920821 12:116789933-116789955 GTGGATGGATGGATGGTGGATGG + Intronic
1103012773 12:117469993-117470015 ATGGATGGATGGATGAAGGATGG - Intronic
1103012774 12:117469997-117470019 ATGGATGGATGGATGGATGAAGG - Intronic
1103012783 12:117470064-117470086 GTGGATGGATGGATGAAGGATGG - Intronic
1103012813 12:117470273-117470295 GTGGATGGATGGATGAAGGATGG - Intronic
1103024063 12:117559068-117559090 ATGGATGGATGGATGGTGGATGG + Intronic
1103111011 12:118278285-118278307 GAGGGTGGAAAGAAGGAGGAGGG - Intronic
1103403941 12:120661543-120661565 ATGGATGGATAGGTAGAGGATGG - Intronic
1103834325 12:123807128-123807150 ATGGATGGATGGATGGATGATGG - Intronic
1103941449 12:124503467-124503489 ATGGATGGATGGATGGATGATGG + Intronic
1103941456 12:124503502-124503524 ATGGATGGATGGACAGAGGATGG + Intronic
1103941465 12:124503557-124503579 ATGGATGGATAGATGGAAGACGG + Intronic
1104034621 12:125089753-125089775 AGGGATGGATAGATGGATGACGG - Intronic
1104034648 12:125089902-125089924 ATGGATGGATAGATGGATAATGG - Intronic
1104034673 12:125090055-125090077 GTGGATGGATAGATGGATGAGGG - Intronic
1104034698 12:125090204-125090226 ATGGATGGATAGATGGATAATGG - Intronic
1104034722 12:125090357-125090379 ATGGATGAATAGATGGATGACGG - Intronic
1104034744 12:125090501-125090523 GTGGATGGAGAGATGGAAGATGG - Intronic
1104034761 12:125090630-125090652 ATGGATGGAGAGATGGATGATGG - Intronic
1104034774 12:125090720-125090742 ATGGATGGATGGATGGATGATGG - Intronic
1104064711 12:125297196-125297218 CAGGGTGGATGGGAGGAGGAGGG + Intronic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1104475272 12:129065967-129065989 CTGGATGGTTGGATGGTGGATGG - Intergenic
1104567607 12:129899325-129899347 ATGGATGGATGGATGGATGATGG + Intronic
1104763962 12:131314548-131314570 ATGGATGGATAGATGGCTGATGG - Intergenic
1104778404 12:131404630-131404652 ATGGATGGATGGATGGATGATGG - Intergenic
1104778423 12:131404708-131404730 ATGGATGGATGGATGGATGATGG - Intergenic
1104778488 12:131404956-131404978 GTGGATGGATGGATGGATGACGG - Intergenic
1104778565 12:131405252-131405274 GTGGATGGATGGATGGATGATGG - Intergenic
1104778641 12:131405513-131405535 GTGGATGGATGGATGGATGATGG - Intergenic
1104779310 12:131409681-131409703 ATGGGTGGATAGATGGATGATGG - Intergenic
1104813936 12:131635130-131635152 ATGGATGGATGGAAGGAAGAAGG - Intergenic
1104813964 12:131635300-131635322 ATGGATGGATGGAAGGAAGAAGG - Intergenic
1104926017 12:132314173-132314195 GTGGATGGATAAATGGATGATGG - Intronic
1105211651 13:18260687-18260709 ATGAATGGATAGAGGGAGGGAGG + Intergenic
1105284727 13:18994724-18994746 CCAGAAGGTTAGAAGGAGGAAGG + Intergenic
1106000584 13:25719479-25719501 ATGGATGGATGGATGGATGATGG + Intronic
1106363188 13:29051170-29051192 CTGGGAGGATGGAAGGAGAAAGG + Intronic
1106565537 13:30881497-30881519 CTTGATGGATGGGAGGAGGCAGG + Intergenic
1106786009 13:33108686-33108708 CCGGATGGATGGAAGGAGGGAGG + Intronic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1107819879 13:44276937-44276959 CTGGAAGGATAGGAGGTTGAGGG + Intergenic
1108123125 13:47211238-47211260 CTGGAGGGATAAAAGCACGATGG + Intergenic
1108224806 13:48277554-48277576 CTGGAAAGAAAGAAGGAGGGAGG + Intergenic
1109577693 13:64283494-64283516 ATGGAAGGAAGGAAGGAGGAAGG + Intergenic
1109642862 13:65213098-65213120 AAGGATGGAAAGAGGGAGGAAGG + Intergenic
1109771489 13:66980259-66980281 CTGGATGGATTGAATGGGGGTGG - Intronic
1110382162 13:74865312-74865334 ATGGATGGATGGATGGAGGGAGG - Intergenic
1112025010 13:95403901-95403923 TTGGATGGATCGCGGGAGGAGGG - Intergenic
1112208126 13:97346088-97346110 CTGGATGGATAGATGATAGATGG + Intronic
1113072883 13:106438685-106438707 ATGGATGGATGGATGGATGATGG + Intergenic
1113072909 13:106438823-106438845 ATGGATGGGTGGAGGGAGGAAGG + Intergenic
1113072948 13:106439011-106439033 ATGGATGGATGAAGGGAGGAAGG + Intergenic
1113127662 13:106998104-106998126 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
1113224736 13:108147356-108147378 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224811 13:108147797-108147819 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224840 13:108147943-108147965 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113386040 13:109849146-109849168 CTGCATGTGTAGAAGGATGATGG + Intergenic
1113387822 13:109866758-109866780 AGGGAGGGAAAGAAGGAGGAAGG + Intergenic
1113417572 13:110140288-110140310 ATGGATGGATGGATGGTGGATGG + Intergenic
1113780267 13:112972749-112972771 GTGGATGGATGGAGGGAGGGAGG + Intronic
1113780280 13:112972814-112972836 ATGGATGGATGGAAGGTGGATGG + Intronic
1113797978 13:113069808-113069830 CTAGAGGGAGAGAAGCAGGAAGG + Intronic
1113959676 13:114119690-114119712 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1113959689 13:114119727-114119749 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1114331695 14:21643462-21643484 CTGGATGGTTTGGAGGAGAAAGG + Intergenic
1114498001 14:23147206-23147228 ATGGATGGATAGATGATGGATGG - Intronic
1115747554 14:36452805-36452827 TTGAATGGATAGAATAAGGAAGG - Intergenic
1116268393 14:42727167-42727189 ATGGATGGATGGAAGAATGAAGG - Intergenic
1116268396 14:42727186-42727208 ATGGATGGATGGAAGATGGATGG - Intergenic
1116268397 14:42727190-42727212 ATGGATGGATGGATGGAAGATGG - Intergenic
1116544058 14:46140749-46140771 TTGGAAGGGTAAAAGGAGGAGGG - Intergenic
1116737414 14:48709677-48709699 CTGGAGGGATAGAATAAGGATGG + Intergenic
1117018885 14:51549199-51549221 ATGGATGGATAGATGGATGGAGG + Intronic
1117478179 14:56118337-56118359 CGGGAGGGAGGGAAGGAGGAGGG - Intronic
1117667111 14:58067776-58067798 CTGGTTGGCTAAAAGGAGTAAGG - Intronic
1118065415 14:62185341-62185363 CTGGAGGGATGGCATGAGGAGGG + Intergenic
1118073398 14:62271120-62271142 GAGGATGGAGAGAGGGAGGATGG - Intergenic
1118104868 14:62647126-62647148 ATGGAGGGATTGAAGGAAGACGG - Intergenic
1118593946 14:67421615-67421637 CTGGATGGATGAATGAAGGAGGG + Intergenic
1118723778 14:68612413-68612435 CGGGAAGGATAGCAAGAGGAAGG - Intronic
1118765179 14:68904737-68904759 CTAGAGGGAGAAAAGGAGGAAGG + Intronic
1118851637 14:69588255-69588277 TTGGATGGATGGATGGATGATGG - Intergenic
1121008055 14:90502916-90502938 GTGGAAGGATAGAAGGATAAAGG + Intergenic
1121047834 14:90800880-90800902 CTGGCTTTAAAGAAGGAGGAAGG + Intronic
1121062234 14:90923425-90923447 ATGGATGGATGGATGGATGATGG - Intronic
1121279302 14:92687826-92687848 CTGGATGGATAGCGGGTGGCGGG - Intronic
1121335607 14:93076034-93076056 ATGGATGGAGAGAAGAGGGAAGG - Intronic
1121423186 14:93830050-93830072 ATGGATGGATGGATGGTGGATGG + Intergenic
1121423210 14:93830168-93830190 ATGGATGGATAGATGGAGGAAGG + Intergenic
1121504702 14:94467989-94468011 CTGGATGGGTAGATGAAGGGTGG + Intronic
1121583961 14:95050229-95050251 ATGGATGGAAGGAAGAAGGAAGG + Intergenic
1121587610 14:95073677-95073699 CTGGGTGGATATAAAAAGGAAGG - Intergenic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121733536 14:96202746-96202768 GTGGATGGATGGAGGGAGGGAGG + Intergenic
1121739969 14:96244806-96244828 ATGGATGCATGGATGGAGGAGGG - Intronic
1121824938 14:97002450-97002472 ATGGATGGATGGATGGGGGATGG - Intergenic
1121835456 14:97088326-97088348 ATGGATGGATGGAAGAATGAAGG - Intergenic
1122083206 14:99281233-99281255 CTGGATCGAGACATGGAGGAAGG + Intergenic
1122355091 14:101118162-101118184 CTGGAAGGAGAGATGGAGGGAGG - Intergenic
1122517483 14:102319084-102319106 CTGGATGGATAGAGAGAGGGTGG + Intronic
1122600704 14:102920301-102920323 GTGGATGGATAGATGGTGGATGG - Intergenic
1122600758 14:102920568-102920590 GTGGATGGATGGATGGTGGATGG - Intergenic
1122600787 14:102920703-102920725 GTGGATGGATGGATGGTGGATGG - Intergenic
1122600892 14:102921282-102921304 CTGAATGGATGGATGGTGGATGG - Intergenic
1122625217 14:103082025-103082047 ATGGATGGATAGGTGGTGGATGG + Intergenic
1122794194 14:104197690-104197712 ATGGATGGATAGATGAAAGATGG - Intergenic
1122813204 14:104299113-104299135 ATGGATGGATGGAAGATGGATGG - Intergenic
1122813205 14:104299117-104299139 ATGGATGGATGGATGGAAGATGG - Intergenic
1122879931 14:104686132-104686154 GTGGATGGGTAGATGGATGAAGG + Intergenic
1122958513 14:105083787-105083809 ATGGATGGGTGGAGGGAGGATGG - Intergenic
1122969791 14:105147889-105147911 CTGTAAGGAGAGGAGGAGGAGGG + Intronic
1123058792 14:105585134-105585156 ATGGATGGATAGATGGAAGAAGG - Intergenic
1123058861 14:105585462-105585484 ATGGATGGATGGATGAAGGATGG - Intergenic
1123083120 14:105705360-105705382 ATGGATGGATAGATGGAAGAAGG - Intergenic
1123083171 14:105705609-105705631 ATGGATGGATGGATGGATGATGG - Intergenic
1123140314 14:106070743-106070765 CTGGATGGATAGAAGAGAGAAGG + Intergenic
1124395798 15:29300316-29300338 ATGGATGGATGGATGGATGATGG + Intronic
1124594720 15:31083030-31083052 CTGGACGGAGACAAGGAGGAAGG + Intronic
1124618440 15:31259862-31259884 AGGGAGGGAAAGAAGGAGGAGGG + Intergenic
1125127880 15:36245597-36245619 GTGGATGGAGAGTAGGAAGAGGG + Intergenic
1125591072 15:40854737-40854759 CTGGATGGAAATAGTGAGGATGG - Intronic
1125969379 15:43899647-43899669 CTGGAAGGAAAGAGGGAGGGAGG - Intronic
1125971367 15:43914488-43914510 CTGGATGGATGGATGATGGATGG - Intronic
1126841774 15:52724411-52724433 CTGGATTGGTAGAAGGAGAAAGG - Intergenic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1128037885 15:64542746-64542768 GGGGATGGAGAGAAGGAGGGTGG - Intronic
1128050133 15:64656795-64656817 CTGGATCTAAAGAAAGAGGAAGG - Intronic
1128311121 15:66632242-66632264 GGGGAAGGAGAGAAGGAGGAGGG + Intronic
1128602297 15:69007437-69007459 CAGGATGGCTATAAAGAGGAGGG + Intronic
1128675942 15:69608447-69608469 CTGGAGGGATGTAAAGAGGAAGG + Intergenic
1128793413 15:70449151-70449173 ATGGATGGAGAGATGGAGGGAGG + Intergenic
1128793449 15:70449275-70449297 GTGGATGGATAGAAGGAAGGAGG + Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129949377 15:79572434-79572456 ATGGAGGGATGGAAGAAGGAAGG + Intergenic
1130688031 15:86056342-86056364 ATGAATGGATACAAGGATGATGG - Intergenic
1130784898 15:87085234-87085256 ATGGATGGATAGATAGATGAGGG - Intergenic
1131161824 15:90110366-90110388 ATGGAGGGAGAGAGGGAGGAAGG + Intergenic
1131549150 15:93341762-93341784 CTGGTTGGAGTGGAGGAGGAAGG - Intergenic
1132030850 15:98437694-98437716 ATGGATGGATGGATGGAGGATGG + Exonic
1132030857 15:98437721-98437743 ATGGATGGATGGATGGATGATGG + Exonic
1132030864 15:98437755-98437777 ATGAATGGATGGATGGAGGATGG + Exonic
1132030881 15:98437847-98437869 ATGGATGGATGGATGGAAGATGG + Exonic
1132030902 15:98437928-98437950 ATAGATGGATGGATGGAGGATGG + Exonic
1132030906 15:98437947-98437969 ATGGATGGATGGAAGATGGATGG + Exonic
1132030914 15:98437981-98438003 ATGGATGGATGGATGGATGATGG + Exonic
1132590099 16:722860-722882 CTGGTTGGAATGAAGGATGATGG - Intronic
1132608690 16:804415-804437 CTGGAAGGACAGAAGCAGGCTGG + Intergenic
1132653736 16:1032936-1032958 ATGGATGGATGGATGGATGATGG - Intergenic
1132653748 16:1032990-1033012 GTGGATGGATGGATGGTGGATGG - Intergenic
1132653854 16:1033506-1033528 ATGGATGGATGGATGGATGATGG - Intergenic
1132653907 16:1033750-1033772 GTGGATGGATGGATGGTGGATGG - Intergenic
1132653923 16:1033813-1033835 ATGGATGGATAGATGGATGATGG - Intergenic
1133204833 16:4227056-4227078 ATGGATGGATGGATGGATGATGG + Intronic
1133326832 16:4947073-4947095 ATGGATGGATGGAGGAAGGAAGG - Intronic
1133326833 16:4947077-4947099 ATGAATGGATGGATGGAGGAAGG - Intronic
1133326873 16:4947257-4947279 ATGGATGGATGGATGGAGGAAGG - Intronic
1133456144 16:5944015-5944037 CTGGATGAATGGATGGTGGATGG - Intergenic
1133530914 16:6653993-6654015 ATGGATGGATGGATAGAGGAAGG + Intronic
1133530916 16:6653997-6654019 ATGGATGGATAGAGGAAGGGTGG + Intronic
1133978132 16:10614923-10614945 AGGGAGGGATGGAAGGAGGAAGG - Intergenic
1134106162 16:11487037-11487059 GTGGATAGATGGAAGGAGGGAGG + Intronic
1134129478 16:11639406-11639428 ATGGATGGTTAGAAGGAGGGAGG + Intergenic
1134224475 16:12380601-12380623 GTGGATGGATGGATGGTGGATGG - Intronic
1134224552 16:12380839-12380861 GTGGATGGATAGATGGTGGGTGG - Intronic
1134224557 16:12380858-12380880 GTGGATGGATAGATGGTGGGTGG - Intronic
1134224579 16:12380930-12380952 GTGGATGGATGGATGGTGGATGG - Intronic
1134287978 16:12879120-12879142 ATGGAGGGAGAGAAGGAGGAAGG - Intergenic
1134392607 16:13833357-13833379 CTTGGTGGTTAGAAGGAAGATGG - Intergenic
1134394959 16:13854232-13854254 AGGGAAGGAGAGAAGGAGGAGGG + Intergenic
1134488430 16:14677723-14677745 ATGGATGGATGGATGGATGATGG + Intronic
1134632231 16:15765123-15765145 ATGGATGGATGGTAGGTGGAAGG + Intronic
1134788004 16:16962459-16962481 ATGGATGGATGGATGGATGAAGG + Intergenic
1135007497 16:18839592-18839614 CTGGAGGGACAGAGGAAGGAAGG + Intronic
1135055011 16:19224561-19224583 GTGGATGGATAGAAGAATGGAGG + Intronic
1135156501 16:20057565-20057587 ATGGAAGGATGGATGGAGGAAGG - Intronic
1135522479 16:23188037-23188059 ATGGATGGAAAGAAGGAAGGAGG - Intronic
1136071396 16:27789700-27789722 ATGGATGGATGGATGGATGATGG + Exonic
1136071418 16:27789826-27789848 GTGGATGGATGGATGAAGGATGG + Exonic
1137385912 16:48042470-48042492 CTGGGTGGAAAGAAGGAAGGAGG - Intergenic
1137386134 16:48044143-48044165 CTGGATGGATGGATGGTGAATGG - Intergenic
1137569421 16:49555628-49555650 ATAGATGGATAGATGGTGGATGG + Intronic
1137579717 16:49626590-49626612 GTGGATGGGTAGATGGAGGATGG - Intronic
1137579736 16:49626700-49626722 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579754 16:49626775-49626797 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579771 16:49626850-49626872 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579781 16:49626892-49626914 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579793 16:49626951-49626973 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579802 16:49626986-49627008 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579819 16:49627061-49627083 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579829 16:49627103-49627125 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579842 16:49627162-49627184 ATTGATGGGTAGATGGAGGATGG - Intronic
1137579857 16:49627229-49627251 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579868 16:49627276-49627298 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579879 16:49627323-49627345 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579891 16:49627374-49627396 ATGGATAGGTAGATGGAGGATGG - Intronic
1137579901 16:49627418-49627440 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579912 16:49627465-49627487 ATGAATGGGTAGATGGAGGATGG - Intronic
1137579924 16:49627524-49627546 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579935 16:49627568-49627590 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579959 16:49627688-49627710 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580000 16:49627866-49627888 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580017 16:49627941-49627963 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580028 16:49627985-49628007 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580038 16:49628032-49628054 ATGGATGGGTAGATGGAAGATGG - Intronic
1137580050 16:49628091-49628113 ATGGATGGGTAGATGGAGGGTGG - Intronic
1137580061 16:49628135-49628157 ATGGATGGGTAGATGGACGATGG - Intronic
1137580085 16:49628245-49628267 ATGGATGGGTAGATGGAGTATGG - Intronic
1137601623 16:49760170-49760192 ATGGATGGATGGATGGATGAGGG + Intronic
1137625611 16:49906099-49906121 ATGGATGGATGGATGGATGATGG + Intergenic
1137798584 16:51242230-51242252 CTGGGTGGATGTATGGAGGAAGG + Intergenic
1137858122 16:51817341-51817363 GAGGATGGAGGGAAGGAGGATGG - Intergenic
1137946231 16:52735500-52735522 CTGGTGGGATAAAGGGAGGATGG - Intergenic
1137979258 16:53055665-53055687 CTGGAGGAATAGGAGGAGGAGGG - Intronic
1138245429 16:55463579-55463601 CTGGCAGGGTAGTAGGAGGAAGG + Intronic
1138440362 16:57030648-57030670 ATGGATGGATGGATGGATGAAGG + Intronic
1138495671 16:57407745-57407767 ATGGATGGATGGATGGATGATGG - Intronic
1138495765 16:57408309-57408331 GTGAATGGATGGATGGAGGATGG - Intronic
1138544021 16:57705707-57705729 ATGGATGGATGGGAGGATGATGG - Intronic
1138547764 16:57729691-57729713 ATGGATGGATGGATGGATGATGG + Intronic
1138547854 16:57730050-57730072 ATGGATGGATGGATGGATGATGG + Intronic
1138600530 16:58051494-58051516 AGGGATGGAAAGAAGGAAGAAGG + Intergenic
1138687736 16:58740462-58740484 CTGGGTTGATAGAGGTAGGAAGG - Intergenic
1138911564 16:61406089-61406111 ATGGGTGGATAGCAGCAGGATGG + Intergenic
1139436078 16:66937265-66937287 CTGGTTGGGTAAAAAGAGGATGG - Intronic
1139766903 16:69238170-69238192 TTGGAGGGAAAGAAGGAGGAGGG + Intronic
1139982645 16:70872436-70872458 ATGGATGGATAGATGATGGATGG - Intronic
1139982737 16:70872795-70872817 CTGCATGGATGGATGGATGATGG - Intronic
1140067722 16:71625499-71625521 GTGGATGGATGGATGGAGGGTGG + Intergenic
1140208128 16:72950017-72950039 ATGGATGGATGAAAGAAGGAAGG + Intronic
1140379120 16:74470394-74470416 ATGGATGGATGGAAGGAGGGAGG - Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140452759 16:75084240-75084262 ATATATGGATGGAAGGAGGAAGG + Intronic
1140541492 16:75760312-75760334 AGGGAGGGATGGAAGGAGGAAGG - Intronic
1140678923 16:77364634-77364656 GTGGATGGATGGATGGTGGATGG + Intronic
1140731897 16:77863954-77863976 ATGGATGGGTAGAGGGAGGCTGG + Intronic
1140853252 16:78954301-78954323 CTGAGTGGATAGAAGGTGGATGG + Intronic
1140989247 16:80192318-80192340 ATAGATGCATAGAAGGAGAAGGG - Intergenic
1141031879 16:80596311-80596333 ATGGATGGATAAAAGGATGATGG + Intergenic
1141110255 16:81265956-81265978 GTGGATGGATAGATGGTGGATGG - Intronic
1141178356 16:81735318-81735340 ATGGATAGATAGATGGATGATGG + Intergenic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1141391323 16:83667070-83667092 AAGGATGGATAGATGGATGATGG + Intronic
1141421505 16:83920883-83920905 ATGGATGGAAGGAAGGAAGATGG + Exonic
1141421528 16:83920982-83921004 ATGGATGGGTGGAAGGAAGATGG + Exonic
1141421538 16:83921019-83921041 GAGGGTGGATAGAAGGAAGATGG + Exonic
1141421553 16:83921085-83921107 TTGGATGGATGGAAGATGGATGG + Exonic
1141421570 16:83921172-83921194 ATGGGTGGATGGAAGGAAGATGG + Exonic
1141421614 16:83921375-83921397 ATGGATGGATAGATGGATGGAGG + Exonic
1141421616 16:83921379-83921401 ATGGATAGATGGATGGAGGAGGG + Exonic
1141421622 16:83921401-83921423 GTGGATGGAAGGAAGGAGGATGG + Exonic
1141430224 16:83967549-83967571 ATGGATGGATGGAAGGATGGTGG + Intergenic
1141430287 16:83967756-83967778 ATGGATGGATGGATGGAGGGTGG + Intergenic
1141430288 16:83967760-83967782 ATGGATGGATGGAGGGTGGATGG + Intergenic
1141483748 16:84325084-84325106 ATGGATGGATGGAGGGATGAAGG - Intronic
1141606498 16:85156941-85156963 ATGGATGGATGGATGGAGAAAGG - Intergenic
1141619786 16:85231001-85231023 ATGGATGGACAGATGGATGATGG + Intergenic
1141619820 16:85231182-85231204 ATGGATGGACAGATGGATGATGG + Intergenic
1141619847 16:85231335-85231357 ATGGATGGACAGATGGATGATGG + Intergenic
1141641943 16:85346612-85346634 ATGGATGGATGGATGGATGATGG + Intergenic
1141641988 16:85346821-85346843 ATGGATGGATGGATGGATGATGG + Intergenic
1141658002 16:85426335-85426357 ATGGATGGATGGAAGAAGGGTGG + Intergenic
1141658065 16:85426598-85426620 ATGGATGGATAAATGGAAGAAGG + Intergenic
1142065639 16:88060863-88060885 CTGGATGGTGAGAGGGAGGGTGG - Intronic
1142124194 16:88402064-88402086 ATGGATGGATAGATGGTAGATGG + Intergenic
1142124216 16:88402151-88402173 ATGGATGGAGAGATGGTGGATGG + Intergenic
1142152386 16:88518401-88518423 GTGGATGGATGGATGGATGATGG + Intronic
1142152470 16:88518757-88518779 ATGGATGGATGGATGGATGATGG + Intronic
1142152563 16:88519134-88519156 ATGGATGGATGGATGGATGATGG + Intronic
1142244718 16:88964783-88964805 CTGGATGGATAGATGGTGGATGG - Intronic
1142899524 17:3003615-3003637 CTGCATGGCTGGAAGGAGGAAGG - Intronic
1142960532 17:3549715-3549737 ATGGATGGATGGATGGAGGATGG + Intronic
1142960552 17:3549877-3549899 ATGGATGGATGGATGGAGGATGG + Intronic
1143116974 17:4586675-4586697 CGGGGTGGATGGAAGGTGGAGGG + Intronic
1143301489 17:5913851-5913873 ATGGATGGATGGAAGATGGATGG - Intronic
1143301490 17:5913855-5913877 ATGGATGGATGGATGGAAGATGG - Intronic
1143500744 17:7337101-7337123 CAGGAAGGGTAGAAGGAGGGTGG - Intronic
1143525379 17:7468858-7468880 CTGGATGGGAAGAAGGAAGATGG + Intronic
1144100697 17:11939828-11939850 ATGGATGGATGGATGGATGATGG + Intronic
1144100717 17:11939922-11939944 ATGGATGGATAGTGGGTGGATGG + Intronic
1144130669 17:12243571-12243593 CTGCTTGCATGGAAGGAGGAAGG - Intergenic
1144966098 17:19078098-19078120 GTGGATGGATAGTGGGTGGATGG + Intergenic
1144981870 17:19174091-19174113 GTGGATGGATAGTGGGTGGATGG - Intergenic
1144986353 17:19204148-19204170 GTGGATGGATAGTGGGTGGATGG + Intergenic
1145271658 17:21407990-21408012 ATGGATGGATGGATGGATGATGG - Intronic
1145898168 17:28472861-28472883 ATGGATGGATGGATGGATGATGG + Intronic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1145978737 17:28999103-28999125 AAGGATGGATGGATGGAGGATGG + Intronic
1146407586 17:32552532-32552554 ATGGATGGATAAAAGGAAGGAGG - Intronic
1146482187 17:33213705-33213727 CTGGGTGGAAAGAAGGGGAAAGG - Intronic
1146489236 17:33268338-33268360 ATGGATGGATGGATGGATGATGG - Intronic
1146626877 17:34441706-34441728 CTGGATGGACAGATGGATGGAGG + Intergenic
1146820874 17:35982917-35982939 ATGGATGGAGAGAAAGAGGGAGG - Intergenic
1146820918 17:35983061-35983083 ATGGATGGATGGATGAAGGAAGG - Intergenic
1146820919 17:35983065-35983087 ATGGATGGATGGATGGATGAAGG - Intergenic
1147193362 17:38749396-38749418 CAGGAGGGAGAGAACGAGGAGGG + Exonic
1147447581 17:40484209-40484231 ATGGTGGGAGAGAAGGAGGAGGG - Intronic
1147598410 17:41731560-41731582 CTGGAGGGAGACAAAGAGGAAGG + Intronic
1148166563 17:45488197-45488219 CTGGATGGAAGGAAGGAGGGAGG - Intronic
1148756633 17:49976536-49976558 AAGGATGGATAGAAGGAGAGGGG - Intergenic
1149453747 17:56770610-56770632 ATGGATGGATAGATGGATGATGG - Intergenic
1149485188 17:57037013-57037035 CTGGGTGGAGAAAAGGAGGCTGG + Intergenic
1149522506 17:57328353-57328375 ATGGATGGATTGATGGATGAAGG - Intronic
1149522510 17:57328376-57328398 ATGGATGGATTGATGGATGAAGG - Intronic
1150397735 17:64834598-64834620 CTGGATGGAAGGAAGGAGGGAGG - Intergenic
1150553378 17:66231437-66231459 TAGGATGAAAAGAAGGAGGAAGG - Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151943281 17:77305924-77305946 GTGGATGGATGGATGGATGATGG + Intronic
1152006601 17:77686084-77686106 ATGGATGGATAGATGGAGGAAGG - Intergenic
1152006655 17:77686339-77686361 TGGGATAGATAGATGGAGGAAGG - Intergenic
1152034054 17:77861163-77861185 ATGGATGAATGGATGGAGGATGG + Intergenic
1152038019 17:77885225-77885247 ATGGATGGATGGATGGAGGATGG + Intergenic
1152047937 17:77950726-77950748 ATGGATGGAAGGAAGGAGGGAGG + Intergenic
1152197862 17:78928150-78928172 GTTGATGGATGGAGGGAGGAGGG - Intergenic
1152434793 17:80269518-80269540 ATGGATGAATAGAAAGAGGATGG - Intronic
1152844821 17:82593342-82593364 CTGGAAGGAAGGAAGGAGGGAGG + Intronic
1153118185 18:1686656-1686678 CTTGATAGATAGAAGTATGAAGG - Intergenic
1153979594 18:10297669-10297691 CTGGAGGGGGAGAAGCAGGAAGG - Intergenic
1154154738 18:11934992-11935014 ATGGAGGGAGAGAGGGAGGAAGG + Intergenic
1155539319 18:26850728-26850750 ATGGATGGATGGATGGATGATGG - Intergenic
1155587683 18:27386428-27386450 ATGAATGGAAAAAAGGAGGAAGG - Intergenic
1155630594 18:27887698-27887720 AGGGATGGAAGGAAGGAGGAAGG - Intergenic
1156471694 18:37381107-37381129 ATGGATGGATGGATGGATGATGG - Intronic
1157163978 18:45341005-45341027 CTGGCTGGATGACAGGAGGATGG - Intronic
1158306278 18:56109664-56109686 CTGGATGAATACAAGGAGAGAGG + Intergenic
1158405175 18:57154106-57154128 CTAGATGAAAAGCAGGAGGAGGG + Intergenic
1158549100 18:58419796-58419818 CTGGATGGATGGATGGATGGAGG + Intergenic
1158574281 18:58623159-58623181 CTGGCTGGGTTGAAGGATGAGGG - Intronic
1160242899 18:77135913-77135935 GTGGAGGGAGAGAAAGAGGAAGG + Intergenic
1160687132 19:442336-442358 GTGGATGGATGGAGGGTGGAAGG + Intronic
1160687368 19:443075-443097 GTGGATGGATGGAGGGTGGATGG + Intronic
1160687643 19:444073-444095 GTGGATGGATGGAGGGTGGATGG + Intronic
1160926593 19:1549637-1549659 ATGGATGGATGGATGGATGAAGG - Intergenic
1161018772 19:1997726-1997748 CTGGAAGGAAAGAGAGAGGATGG - Intronic
1161049782 19:2157095-2157117 ATGGATGGATGGATGGATGATGG - Intronic
1161105242 19:2440544-2440566 GTGGATGGATGGATGGATGATGG - Intronic
1161105248 19:2440567-2440589 GTGGATGGATGGATGGATGATGG - Intronic
1161105286 19:2440809-2440831 CTGGATGGGTGGACGGATGATGG - Intronic
1161258516 19:3322891-3322913 GTGGATGGATAGATGGATAAAGG + Intergenic
1161258539 19:3322991-3323013 GTGGATGGATAGATGGACAAAGG + Intergenic
1161329088 19:3677949-3677971 AGGGATGGATGGATGGAGGATGG + Intronic
1161329217 19:3678432-3678454 GAGGATGGAGAGATGGAGGATGG + Intronic
1161407356 19:4097995-4098017 CTGGCTGGAGAGGAGGAGGTGGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161489390 19:4553609-4553631 ATGGATGGATAGATGAAGGATGG + Intronic
1161633119 19:5369343-5369365 GTGGATGAATAGATGGATGATGG - Intergenic
1161934598 19:7363900-7363922 GTTGATGGAAGGAAGGAGGATGG + Intronic
1161934619 19:7364016-7364038 GTGGATGAAAGGAAGGAGGATGG + Intronic
1161934656 19:7364245-7364267 GTTGATGGAAGGAAGGAGGATGG + Intronic
1161939220 19:7392282-7392304 TTGGATGGATAAAAGAAAGATGG + Intronic
1162062935 19:8107688-8107710 ATGAATGGGTAGATGGAGGATGG + Intronic
1162085858 19:8248753-8248775 TTGGATGGATGGATGGATGATGG + Intronic
1162155990 19:8678257-8678279 ATGCATGGATAAATGGAGGATGG - Intergenic
1162180842 19:8867693-8867715 ATGGATGGATGGATGGTGGATGG + Intronic
1162203314 19:9036997-9037019 ATGGATGAATAGAAGATGGATGG + Intergenic
1162743114 19:12784125-12784147 CTGGCTGGACAGACGGAGGAGGG + Intronic
1163010209 19:14420494-14420516 GTGGAGGGAAAGAGGGAGGAAGG - Intergenic
1163038106 19:14583299-14583321 CTTGAGGGATGGAGGGAGGAGGG + Intronic
1163038795 19:14587556-14587578 CTTGAGGGATGGAGGGAGGAGGG + Intronic
1163039541 19:14592223-14592245 CTTGAGGGATGGAGGGAGGAGGG + Intronic
1163049483 19:14671387-14671409 CTGGATTTAAAGAAGGAGGAAGG - Intronic
1163214794 19:15868476-15868498 ATGGATGGAGGGAGGGAGGAAGG + Intergenic
1163218175 19:15895988-15896010 ATGGATGGATGGATGGATGATGG - Intronic
1163273404 19:16267623-16267645 CAGGTTGGATGGGAGGAGGAGGG + Intergenic
1163382599 19:16978805-16978827 ATGGATGGGTAGATGGTGGATGG - Intronic
1163382678 19:16979155-16979177 ATGGATGGATAGTGGGTGGATGG - Intronic
1163383586 19:16985456-16985478 ATGGATGGATGGATGGATGAAGG + Intronic
1163383633 19:16985655-16985677 ATGAATAGATAGATGGAGGATGG + Intronic
1163409629 19:17145936-17145958 ATGGATGGATGGATGGATGATGG + Intronic
1163462268 19:17446181-17446203 ATGGATGGATGGATGGATGAGGG - Intronic
1163571257 19:18083697-18083719 ATGGATGGGTAGATGGTGGACGG - Intronic
1163571381 19:18084271-18084293 ATGGATGGATAGATGGATGGGGG - Intronic
1163609963 19:18295587-18295609 GTGGATGGGTAGATGGTGGATGG - Intergenic
1163609997 19:18295729-18295751 ATGGATGGATGGATGGTGGATGG - Intergenic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1164462584 19:28461705-28461727 CTGGCTGGATAGAAGGTTGGGGG - Intergenic
1164670370 19:30068948-30068970 GTGGATGGATAAATGGAGGAAGG - Intergenic
1164701403 19:30287447-30287469 ATGGGTGGATTGATGGAGGATGG + Intronic
1164706510 19:30324033-30324055 ATGGATAGATGGATGGAGGATGG - Intronic
1164797296 19:31044403-31044425 ATGGATGGATGGATGGATGAAGG + Intergenic
1164797438 19:31045301-31045323 ATGGATGGATAGATGGAGACTGG + Intergenic
1165063317 19:33215585-33215607 CTGGATGGAGAGAAGGTGTGGGG - Intronic
1165098359 19:33422781-33422803 ATGGATAGATAGAGGGAGGGAGG - Intronic
1165098361 19:33422785-33422807 ATGGATGGATAGATAGAGGGAGG - Intronic
1165144390 19:33722093-33722115 ATGGATGGATGGATGGATGAAGG + Intronic
1165190281 19:34057281-34057303 ATGGATGGATAGATGGGAGATGG + Intergenic
1165787073 19:38468045-38468067 ATGGATGGATGGATGGATGATGG - Intronic
1165787101 19:38468204-38468226 ATGGATGGATGGATGGATGATGG - Intronic
1166647678 19:44544195-44544217 ATGGATGGATGGATGGATGACGG - Intergenic
1166863145 19:45821172-45821194 CTGGGAGGAAGGAAGGAGGAGGG + Intronic
1166935606 19:46330627-46330649 ATGGATGGATGGATGGTGGATGG + Intronic
1166935621 19:46330707-46330729 ATGGATGGATGGATGGTGGATGG + Intronic
1166935641 19:46330792-46330814 ATGGATGGATGGATGGTGGATGG + Intronic
1166944087 19:46386519-46386541 CTGGAAGGGAAGAAGGAGGCCGG + Intronic
1167040125 19:47019120-47019142 CTGCATGGAGAGAAGGAGCTAGG + Intergenic
1167126175 19:47550279-47550301 CAGGAAGGAAGGAAGGAGGAAGG + Intronic
1167144159 19:47672101-47672123 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144174 19:47672163-47672185 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144182 19:47672194-47672216 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144205 19:47672285-47672307 GTAGATGGATAGATGAAGGATGG + Intronic
1167144213 19:47672316-47672338 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144221 19:47672347-47672369 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144229 19:47672378-47672400 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144247 19:47672441-47672463 GTGGATGGAAAGATGGAGGGAGG + Intronic
1167144273 19:47672585-47672607 ATGGATGGATGGATGGAGGCAGG + Intronic
1167161409 19:47769678-47769700 ATGGATGGATAGATGATGGATGG - Intergenic
1167161417 19:47769727-47769749 ATGGATGGATGGATGGATGATGG - Intergenic
1167161425 19:47769762-47769784 ATGGATGGATGGATGGATGATGG - Intergenic
1167168964 19:47818337-47818359 ATGGATGGATGGATGGATGATGG - Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167339035 19:48903962-48903984 GTGGATGGATGGATGGATGATGG + Intronic
1167538980 19:50073471-50073493 CTGGAGGAAGAGAAGCAGGACGG + Intergenic
1167556046 19:50196394-50196416 ATGGATGGATGGATGGATGATGG - Intronic
1167601287 19:50456289-50456311 ATGGATGGATGGATGGATGATGG - Intronic
1167634213 19:50644616-50644638 TTGAATGGATAGAAGATGGATGG + Intronic
1167685241 19:50951903-50951925 CTGGAGGGATAGAGGGTGCAGGG - Intronic
1167801846 19:51748173-51748195 AAGGAAGGAAAGAAGGAGGAAGG + Intronic
1168326912 19:55543201-55543223 GTGGATGGATGGATGGTGGATGG - Intronic
1168414312 19:56159055-56159077 GTGGATGGATGGACGGATGATGG - Intronic
1168421077 19:56204155-56204177 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168424367 19:56226765-56226787 CTGGAGGGATAGAGGGAGGGAGG + Intronic
1168426305 19:56241978-56242000 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168508245 19:56954471-56954493 ATGGATGGATAGTGGGTGGATGG - Intergenic
1168508273 19:56954608-56954630 ATGGGTGGATAGATGGAGGATGG - Intergenic
1202713108 1_KI270714v1_random:28132-28154 CTGGAAGGAGGGAGGGAGGAAGG - Intergenic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925293742 2:2764641-2764663 CTGGAAGGAGGGAAGGAGGGAGG + Intergenic
925347763 2:3182906-3182928 CTGGATGGGTGGATGGATGATGG - Intergenic
925541185 2:4969547-4969569 ATGGATGGATGGATGGATGATGG - Intergenic
925627040 2:5851939-5851961 ATGGATGGATGGAAGGATGGAGG - Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925745313 2:7038911-7038933 GTGGATGGATAGATGGATGATGG + Intronic
925745375 2:7039237-7039259 ATGGATGGAGAGATGGATGATGG + Intronic
925925677 2:8668372-8668394 ATGGATGGATGGATGGATGAAGG + Intergenic
925925705 2:8668504-8668526 CTGGATGGAGTGATGGATGAAGG + Intergenic
926109080 2:10170682-10170704 CAGGTTGGAGAGAAGGAGGAGGG - Intronic
926214018 2:10892604-10892626 ATGGATGGATGGATGGAAGAAGG - Intergenic
926698626 2:15787910-15787932 ATGGACGGATGGAAGGAAGATGG - Intergenic
926808758 2:16737857-16737879 CTTGATGTATAGATGGAGGAAGG - Intergenic
927197747 2:20559732-20559754 ATGGATGGATGGATGGATGATGG + Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927431713 2:23031826-23031848 ATGGATGGAAGGAGGGAGGAAGG - Intergenic
927431714 2:23031830-23031852 ATGGATGGATGGAAGGAGGGAGG - Intergenic
927451013 2:23209698-23209720 CTGGATGGATGGTAGGGGGAGGG - Intergenic
927685859 2:25169854-25169876 CTGGATGGCTGGAGAGAGGAAGG - Intergenic
927714256 2:25342047-25342069 CCGGAGGGAGGGAAGGAGGAAGG - Intronic
927827266 2:26317469-26317491 GTGTATGGACAGGAGGAGGAGGG - Intronic
927855593 2:26525707-26525729 ATGGATGGAAGGAAGGATGATGG + Intronic
927984709 2:27400894-27400916 TTGGATGGATACCAGCAGGATGG - Intronic
927999153 2:27507771-27507793 CTGGATGGTGAGAGGGAAGATGG + Exonic
928177512 2:29044965-29044987 ATGGATGGATGGATGGATGATGG - Intronic
928902548 2:36335954-36335976 CTGTAAGAATAGAAGGATGAGGG + Intergenic
929171114 2:38934434-38934456 AGGGAGGGATAGAAGGGGGAGGG - Intronic
929851598 2:45596258-45596280 CTTGCTGAATAGAATGAGGAGGG - Intronic
929865684 2:45715494-45715516 CTGGATAGATGGAAGCAAGAGGG - Intronic
930020560 2:46999379-46999401 CTGGATGGATGAATGGGGGATGG - Intronic
930237435 2:48901527-48901549 CTGGATGGTCAGAAGGAGCAGGG - Intergenic
930569460 2:53066553-53066575 CTGGATGAATAGATGATGGATGG + Intergenic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
931854634 2:66289010-66289032 ATGGATAGAGAGTAGGAGGATGG - Intergenic
931972339 2:67602639-67602661 ATGGATGGATGGATGGATGATGG + Intergenic
932019889 2:68073688-68073710 CTGCAAGGATAGAAGATGGAAGG - Intronic
932463159 2:71896400-71896422 ATGGATGGATGGTTGGAGGAGGG + Intergenic
932697372 2:73968234-73968256 CTGGGTGGCTGGAAGGATGATGG - Intergenic
933313953 2:80693602-80693624 CAAGAAGAATAGAAGGAGGAAGG + Intergenic
933332570 2:80913077-80913099 AGAGATGGATGGAAGGAGGAAGG + Intergenic
933665003 2:84957770-84957792 CTGGATGCTTAGAGGAAGGAAGG - Intergenic
933736230 2:85496928-85496950 CTTGATGGATAGAAGATGAAGGG + Intergenic
933968216 2:87447991-87448013 CTGGATGGATGGATGGTAGATGG + Intergenic
934263651 2:91498371-91498393 AAGGAAGGAAAGAAGGAGGAAGG - Intergenic
934301970 2:91781768-91781790 ATGAATGGATAGAGGGAGGGAGG - Intergenic
934656974 2:96121504-96121526 CTGGAAGGTTTGAAGGAAGATGG - Intergenic
934904097 2:98184277-98184299 CTGCAAGGATGGAAGGAGAAAGG - Intronic
934920247 2:98337875-98337897 CTGGATGGATGGATGGATGATGG - Intronic
935124041 2:100207402-100207424 CATGAGGGACAGAAGGAGGAAGG - Intergenic
935404254 2:102691525-102691547 ATAGATGGATTGAAGAAGGAAGG + Intronic
935451475 2:103214586-103214608 TTGGATGGATGGTGGGAGGAAGG - Intergenic
935454473 2:103251246-103251268 GGGGATGGATAGATGGAGCACGG - Intergenic
935626659 2:105177269-105177291 AAGGAAGGAGAGAAGGAGGAAGG - Intergenic
935702571 2:105825093-105825115 CTGGAGGGAGAGGAGGAGGCAGG - Intronic
935782322 2:106519059-106519081 ATGGATGGATGGATGGATGATGG - Intergenic
936125457 2:109785876-109785898 CTGAATGGGTAGACTGAGGATGG + Intergenic
936219236 2:110585592-110585614 CTGAATGGGTAGACTGAGGATGG - Intergenic
936243980 2:110810636-110810658 ATGGATGGATGGATGGATGATGG - Intronic
936325581 2:111502513-111502535 CTGGATGGATGGATGGTAGATGG - Intergenic
936615951 2:114047987-114048009 ATGGACGGATGGATGGAGGATGG - Intergenic
937082641 2:119151402-119151424 ATGGATGGATAGAGGGATGGAGG - Intergenic
937111045 2:119367333-119367355 CTTGATGGAGAGATGGGGGAAGG + Intronic
937134771 2:119543240-119543262 CTGGTGGGTTAGAAGGAGGGTGG + Intergenic
937207231 2:120244613-120244635 ATGGATGGATGGATGGATGAGGG - Intronic
937268490 2:120632292-120632314 ATGGATGGATGGATGGGGGACGG + Intergenic
937311340 2:120905218-120905240 AGGGAGGGAGAGAAGGAGGAGGG + Intronic
937609739 2:123846414-123846436 AGGGATGACTAGAAGGAGGATGG + Intergenic
938061195 2:128255719-128255741 CTGGAAGGAGAGAAGAAAGAGGG + Intronic
938062343 2:128263240-128263262 CTGGCAGGATAGAAGGGGGCAGG + Intronic
938108073 2:128546804-128546826 ATGGATGGATGGATGGAGAATGG - Intergenic
938108156 2:128547180-128547202 ATGGATGGATAGATGGAGAATGG - Intergenic
938150142 2:128875433-128875455 CTGGAAGTATAGGAGCAGGAAGG - Intergenic
938169566 2:129062963-129062985 ATGGATGGATGGATGGATGATGG - Intergenic
938872414 2:135494084-135494106 ATGGATGGATAGAAATAGAAAGG + Intronic
939220429 2:139294579-139294601 GTGGAAGGAAAGAAGGAGAAAGG + Intergenic
939548797 2:143588020-143588042 CTGTTTGGAAAGAAGGAAGAGGG - Intronic
939820063 2:146946643-146946665 GAGGGTGGAGAGAAGGAGGAGGG + Intergenic
939858310 2:147387783-147387805 CTGGAAGGATATAAAGAGGGAGG - Intergenic
940115484 2:150204076-150204098 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
940669861 2:156654081-156654103 CTGGAAGGCAAGAAAGAGGAAGG - Intergenic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
941344613 2:164352203-164352225 CTGGATAGATAGTAGGAGAGAGG - Intergenic
941465137 2:165816703-165816725 TTGGAAGGGTAGAAGGTGGATGG + Intergenic
941670105 2:168283961-168283983 CTGGAGGGACGGAAGGAGGAGGG + Intergenic
941925679 2:170892051-170892073 CTGGGTGGAGGGAAGGAGGAGGG + Intergenic
942409896 2:175697964-175697986 AAAGATGGATAGAAGGAAGATGG + Intergenic
942618074 2:177815554-177815576 TGGGAGGGAAAGAAGGAGGAAGG - Intronic
942831373 2:180240083-180240105 GTGGATTGATAGAAGGAGCATGG + Intergenic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
943382773 2:187171830-187171852 CTGGGTTCATAGAAGGAGAAAGG + Intergenic
944015153 2:195026952-195026974 GTGGATGGATTGAGGCAGGAAGG + Intergenic
944059127 2:195553678-195553700 TTGGTTGGATAGGAGGAGGTTGG - Intergenic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
945270055 2:207929053-207929075 CTGAATGGATAGATGGAAGGAGG - Intronic
945545336 2:211143360-211143382 CTGGTTTCATAGAAAGAGGAAGG + Intergenic
946172994 2:217906306-217906328 GTGGATGGGGAGAAGAAGGATGG - Intronic
946486474 2:220105323-220105345 CTGGGTGGAGAGAGGAAGGAGGG + Intergenic
947030218 2:225783530-225783552 CTGGAAGGAAGGAAGGAGGGAGG - Intergenic
947233680 2:227918168-227918190 ATGGATGGATGGATGGATGATGG - Intronic
947537966 2:230952830-230952852 CTGGAAGGAAGGAAAGAGGAGGG - Intronic
947728113 2:232412871-232412893 CTGGATTGTAAGAAGGAGGGAGG + Intergenic
947812767 2:233014845-233014867 TTGGATGGATAGATGGTGGGTGG - Intronic
947812837 2:233015136-233015158 GTGGATGGATGGATGGTGGATGG - Intronic
947812851 2:233015186-233015208 ATGGATGGATAGATGGTGGGTGG - Intronic
947812912 2:233015413-233015435 GTGGATGGATGGATGGTGGATGG - Intronic
947812932 2:233015496-233015518 GTGGATGGATGGATGGTGGATGG - Intronic
948018687 2:234712330-234712352 CTGTATGGATAGAAGTGGGTTGG + Intergenic
948067348 2:235091116-235091138 ATGGATGGATGGATGGGGGAGGG - Intergenic
948193949 2:236081105-236081127 CTGGATGGAAAGAAATAGGCAGG - Intronic
948570868 2:238916426-238916448 AGGGAGGGAAAGAAGGAGGAGGG + Intergenic
948576106 2:238950657-238950679 CTTGATGGACCGGAGGAGGATGG - Intergenic
948769192 2:240239517-240239539 GTGGATGGATAGATGGCAGATGG + Intergenic
949065748 2:241989561-241989583 GTGGATGGATGGATGGTGGATGG - Intergenic
949065752 2:241989576-241989598 ATGGATGGATGGATGGTGGATGG - Intergenic
949065765 2:241989631-241989653 ATGGATGGATGGATGGTGGATGG - Intergenic
949065788 2:241989733-241989755 GTGGATGGATGGATGGTGGATGG - Intergenic
949065806 2:241989811-241989833 ATGGATGGATGGATGGTGGATGG - Intergenic
949065838 2:241989948-241989970 GTGGATGGATGGATGGTGGATGG - Intergenic
949065854 2:241990011-241990033 ATGGATGGATGGATGGATGATGG - Intergenic
949065920 2:241990289-241990311 ATGGATGGATGGATGGTGGATGG - Intergenic
949065938 2:241990354-241990376 ATGGATGGATGGATGGTGGATGG - Intergenic
949065955 2:241990422-241990444 ATGGATGGATGGATGGTGGATGG - Intergenic
949065977 2:241990504-241990526 ATGGATGGATGGATGGTGGATGG - Intergenic
949065986 2:241990537-241990559 ATGGATGGATGGATGGTGGATGG - Intergenic
949065992 2:241990560-241990582 ATGGATGGATGGATGGTGGATGG - Intergenic
949066000 2:241990591-241990613 GTGGATGGATGGATGGTGGATGG - Intergenic
1169211089 20:3766728-3766750 CAGGATGGATAGAATGTGGGGGG + Intronic
1169244429 20:4015045-4015067 CTGGGAGGCTAGGAGGAGGATGG - Intronic
1170148091 20:13199390-13199412 ATGGAGGGAGGGAAGGAGGACGG - Intergenic
1170168625 20:13386583-13386605 CTGGATGGAAGGAGGGAAGAAGG - Intergenic
1170312841 20:15011671-15011693 CTGGATGGAGAGAGAGGGGAAGG - Intronic
1170361177 20:15548084-15548106 ATGGATGAATGGATGGAGGAAGG - Intronic
1170458348 20:16554093-16554115 CTGGGTAGAAAGAAGGAGGTGGG + Intronic
1170814753 20:19704195-19704217 ATGGATGGATAGATGGATGGAGG + Intronic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1171119170 20:22553327-22553349 ATGCATGGATGGAAGGAGGCTGG + Intergenic
1171399178 20:24860730-24860752 ATGGGTGGATAGATGGAGGGAGG + Intergenic
1172203981 20:33148922-33148944 ATGGATGGATGGATGGATGATGG + Intergenic
1172592751 20:36128957-36128979 GTGGGTGGAGAGAGGGAGGAAGG + Intronic
1172654876 20:36530570-36530592 CTGGATGGATAAAAGGGAGAAGG - Intergenic
1172806750 20:37617511-37617533 CTGAATGGCTGGAAGGATGAAGG + Intergenic
1172876296 20:38166328-38166350 ATGGATGGATTGAGGGAGGGAGG - Intronic
1172919510 20:38469413-38469435 ATGGATGGATGGATGGATGAGGG - Intergenic
1173087697 20:39940065-39940087 ATGGATGGATAGATGGATGGAGG + Intergenic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173502974 20:43566885-43566907 GTGGGTGGGTAGAAGGAGGGAGG + Intronic
1173741497 20:45405726-45405748 GTGGATGGAAGGCAGGAGGAAGG + Intronic
1173871491 20:46344859-46344881 ATGGATGGGTAGATGGATGATGG - Intergenic
1173871501 20:46344909-46344931 ATGGATGGATGGATGGATGATGG - Intergenic
1174275508 20:49400967-49400989 ATGGATGAATAGAAGAAGGAAGG - Intronic
1174392913 20:50228904-50228926 CTGGTTGGATAGAGGGAAAAAGG - Intergenic
1174550967 20:51361257-51361279 CTGGCTTGGTAGATGGAGGAAGG - Intergenic
1174559418 20:51419425-51419447 CTGGATGGGAAAAAAGAGGAAGG - Intronic
1174746952 20:53072954-53072976 ATGGAGGGATAGATGGATGAAGG - Intronic
1174747007 20:53073165-53073187 ATGGAGGGATAGATGGATGAAGG - Intronic
1174747025 20:53073241-53073263 ATGGAAGGATAGATGAAGGAAGG - Intronic
1174747037 20:53073293-53073315 ATGGATGGATGGATGGATGAAGG - Intronic
1175165282 20:57039176-57039198 TTGGATGGATGGATGGATGATGG + Intergenic
1175165322 20:57039411-57039433 ATGGATGGATGGATGGATGATGG + Intergenic
1175305302 20:57971789-57971811 AAGGATGGATGGATGGAGGATGG + Intergenic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175407375 20:58743968-58743990 GTGGGTGGATACATGGAGGAGGG + Intergenic
1175687957 20:61045103-61045125 ATGGATGGATGAAAGGTGGATGG - Intergenic
1175687964 20:61045134-61045156 ATTGATGGATGGATGGAGGATGG - Intergenic
1175687983 20:61045213-61045235 ATGGATGAATAGACGGAGGATGG - Intergenic
1175687992 20:61045277-61045299 ATGGATGGATAGATGGTTGATGG - Intergenic
1175687995 20:61045296-61045318 ATGGATGGATGGATGGTGGATGG - Intergenic
1175770498 20:61620398-61620420 ATGGATAGATAGATGGATGATGG + Intronic
1175770505 20:61620469-61620491 ATGGATAGATAGATGGATGATGG + Intronic
1175772631 20:61633182-61633204 ATGGATGAATGGATGGAGGATGG - Intronic
1175779244 20:61671862-61671884 ATGGATGGATGGATGGTGGATGG + Intronic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175781064 20:61682358-61682380 ATGGATGGATGGATGGTGGATGG + Intronic
1175798470 20:61787095-61787117 ATGGATGGATGGATGGATGATGG - Intronic
1175798990 20:61790294-61790316 ATGGATGGATAGTGGGTGGATGG - Intronic
1175817239 20:61889627-61889649 ATGGATGGATAGGTGGATGATGG + Intronic
1175817250 20:61889696-61889718 ATGGATGGATAGATGATGGATGG + Intronic
1175817281 20:61889855-61889877 ATGGATGGATAGATGGATGGTGG + Intronic
1175817288 20:61889894-61889916 ATGGATGGATAGATGATGGATGG + Intronic
1175817341 20:61890180-61890202 ATGGATGGATAGATGATGGATGG + Intronic
1175817343 20:61890195-61890217 ATGGATGGATAGATGGATGTTGG + Intronic
1175817363 20:61890306-61890328 ATGGATGGATAGATGGATGATGG + Intronic
1175817381 20:61890398-61890420 GTGGATGGATGGATGGATGATGG + Intronic
1175817390 20:61890444-61890466 ATGGATGGATAAATGGATGATGG + Intronic
1175983974 20:62755157-62755179 GTGGAGGGATAGAAGGAGGAAGG - Intronic
1175984022 20:62755320-62755342 ATGGATGGAGGGAGGGAGGAAGG - Intronic
1175984023 20:62755324-62755346 ATGGATGGATGGAGGGAGGGAGG - Intronic
1175984136 20:62755659-62755681 ATGGATGGAGGGAGGGAGGATGG - Intronic
1175984188 20:62755810-62755832 ATGGATGGAGGGAGGGAGGATGG - Intronic
1176069932 20:63220923-63220945 GTGGATGGACAGCAGGAGGCAGG + Intergenic
1176087251 20:63303800-63303822 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
1176130045 20:63492938-63492960 GTGGATGGATGGACAGAGGATGG + Intronic
1176292197 21:5052350-5052372 ATGGATGGATGGAGGGAGGGAGG - Intergenic
1176292215 21:5052392-5052414 ATGGATGGATGGAGGGAGGGAGG - Intergenic
1176292281 21:5052596-5052618 ATGGAGGGATAGAAGGATGGAGG - Intergenic
1176292331 21:5052766-5052788 ATGGAAGGATGGAAGGAGGAGGG - Intergenic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1177943371 21:27438240-27438262 ATGGATGGATGAAAGGAGAAAGG + Intergenic
1178163945 21:29950273-29950295 AAGGAAGGAAAGAAGGAGGAAGG - Intergenic
1178278118 21:31257608-31257630 ATGGATTGATGGAAGGAAGATGG - Intronic
1178666274 21:34549801-34549823 ATGGATGGATGGATGGATGATGG - Intronic
1178689667 21:34740568-34740590 ATGGATGGATGGATGGACGATGG - Intergenic
1179007658 21:37529454-37529476 ATGGATGGATGGATGGAGGGAGG + Intergenic
1179007660 21:37529458-37529480 ATGGATGGATGGAGGGAGGGAGG + Intergenic
1179017465 21:37605653-37605675 ATGGATGGATGGATGGATGAAGG - Intergenic
1179081882 21:38178977-38178999 CTGAAAGGAAAGATGGAGGATGG - Intronic
1179141139 21:38726530-38726552 AAGGAAGGAAAGAAGGAGGAGGG - Intergenic
1179145084 21:38760994-38761016 CTGGAGTGAAAGAAGGAGAAAGG - Intergenic
1179474741 21:41635981-41636003 GTGGATGTATAGAAGGATGATGG - Intergenic
1179623659 21:42634811-42634833 ATGGATGGAGAGAAAGATGATGG - Intergenic
1179623673 21:42634925-42634947 ATGGATGGATAGAAGGATGATGG - Intergenic
1179623687 21:42635031-42635053 ATGGATGGAGAGAAGGATGATGG - Intergenic
1179623701 21:42635141-42635163 ATGGATGGAGAGAAGGATGATGG - Intergenic
1179623717 21:42635255-42635277 ATGGATGGAGAGAAGAATGATGG - Intergenic
1179623729 21:42635365-42635387 ATGGATGGATAGAAGGATGATGG - Intergenic
1179623741 21:42635471-42635493 ATGGATGGATAGAAGGATGATGG - Intergenic
1179623755 21:42635581-42635603 ATGGATGGAGAGAAGGATGATGG - Intergenic
1179864929 21:44210892-44210914 ATGGAAGGATGGAAGGAGGAGGG + Intergenic
1179864979 21:44211062-44211084 ATGGAGGGATAGAAGGATGGAGG + Intergenic
1179865062 21:44211304-44211326 ATGGATGGATGGAGGGAGGGAGG + Intergenic
1179884984 21:44309996-44310018 CTGGTTGGGGAGAAGGCGGAGGG + Intronic
1180024921 21:45155653-45155675 CTAGATGGAGAGATGGATGATGG - Intronic
1180024957 21:45155819-45155841 GTGGATGGATGGATGGATGATGG - Intronic
1180025082 21:45156292-45156314 GTGGATGGATGGATGGATGATGG - Intronic
1180025094 21:45156336-45156358 GTGGATGGATAGATGGATGATGG - Intronic
1180025105 21:45156380-45156402 ATGGATGGATGGATGGATGATGG - Intronic
1180814459 22:18780955-18780977 ATGAATGGATAGAGGGAGGGAGG + Intergenic
1181200647 22:21215291-21215313 ATGAATGGATAGAGGGAGGGAGG + Intronic
1181482148 22:23206962-23206984 ATGGATGGATGGAGGGAGGGAGG - Intronic
1181482150 22:23206966-23206988 ATGGATGGATGGATGGAGGGAGG - Intronic
1181536730 22:23550160-23550182 ATGGATGGGTAGATGGATGATGG - Intergenic
1182052766 22:27325622-27325644 GTGGATGGATGGATGGAAGATGG + Intergenic
1182072018 22:27470361-27470383 GTGGATGGATGGATGGATGATGG + Intergenic
1182099733 22:27649414-27649436 ATGGATGGATGGATGGATGATGG + Intergenic
1182099741 22:27649441-27649463 GTGGATGGATGGATGGTGGAAGG + Intergenic
1182354198 22:29714945-29714967 CTGCTGGGAGAGAAGGAGGAGGG + Intergenic
1182862079 22:33568868-33568890 ATGGATGGATGGATGGATGATGG + Intronic
1183082162 22:35463478-35463500 ATGGATGGATAGTGGGTGGATGG - Intergenic
1183100012 22:35578237-35578259 CTGGCTGGATGGATGGTGGATGG + Intergenic
1183100052 22:35578396-35578418 CTGGATGGATGGATGGTGGATGG + Intergenic
1183100062 22:35578439-35578461 ATGGATGGATGGATGGTGGATGG + Intergenic
1183106509 22:35618870-35618892 ATGGATGGATAGATGGATGGAGG - Intronic
1183106541 22:35618998-35619020 ATGGATGGATAGATGGATGGAGG - Intronic
1183262291 22:36803516-36803538 ATGGATGGACAGATGGAGGGAGG + Intronic
1183303932 22:37071974-37071996 ATGGATGGATGGATGGATGATGG + Intronic
1183303979 22:37072216-37072238 ATGGATGGATGGATGGATGATGG + Intronic
1183304003 22:37072341-37072363 ATGGATGGATGGATGGATGATGG + Intronic
1183304027 22:37072467-37072489 ATGGATGGATGGATGGATGATGG + Intronic
1183304042 22:37072561-37072583 ATGGATGGATGGATGGATGATGG + Intronic
1183304049 22:37072595-37072617 ATGGATGGATGGATGGATGATGG + Intronic
1183304080 22:37072749-37072771 ATGGATGGATAGATGGATGATGG + Intronic
1183304090 22:37072798-37072820 ATGGATGGATGGATGGATGATGG + Intronic
1183304094 22:37072821-37072843 ATGGATGGATAGACGGATGATGG + Intronic
1183304098 22:37072840-37072862 ATGGATGGATGGATGGATGATGG + Intronic
1183304122 22:37072980-37073002 ATGGATGGATAGATGGATGATGG + Intronic
1183304128 22:37073010-37073032 ATGGATGGATGGATGGATGATGG + Intronic
1183304142 22:37073075-37073097 ATGGATGGATAGACGGATGATGG + Intronic
1183321929 22:37170114-37170136 ATGGATGGATGGATGGATGAAGG + Intronic
1183467298 22:37986193-37986215 CTGGATGGACAGAGGGACGAGGG + Intronic
1183539667 22:38422857-38422879 CAGGATGGAGAGAATGAAGAGGG - Intergenic
1183598204 22:38824873-38824895 CTGGAGGGGGAGGAGGAGGAGGG - Intronic
1183600024 22:38834597-38834619 ATGGATGGATGGATGGATGATGG - Intronic
1183698796 22:39438158-39438180 AGGGATGGAGGGAAGGAGGAAGG - Intergenic
1183729958 22:39612829-39612851 AAGGAGGGAGAGAAGGAGGAAGG - Intronic
1184089355 22:42284119-42284141 AGGGATGGATGGATGGAGGAGGG + Intronic
1184293036 22:43508463-43508485 ATGGATGGACAGATGGGGGATGG - Intergenic
1184293047 22:43508506-43508528 ATGGATGGATAGATGGATGGGGG - Intergenic
1184293071 22:43508583-43508605 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293111 22:43508715-43508737 ATGGATGGATAGAGAGAGGGAGG - Intergenic
1184293145 22:43508832-43508854 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293156 22:43508867-43508889 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293193 22:43508991-43509013 ATGGATGGATGGATGGGGGATGG - Intergenic
1184293202 22:43509018-43509040 ACGGATGGATGGATGGAGGATGG - Intergenic
1184293207 22:43509037-43509059 ATGGATGGATAGGTGGGGGACGG - Intergenic
1184293266 22:43509227-43509249 ATGGATGGATGGATGGGGGATGG - Intergenic
1184293283 22:43509277-43509299 ATGGACGGATAGATGGAGGATGG - Intergenic
1184293314 22:43509389-43509411 ATGGATGGGTAGATGGGGGATGG - Intergenic
1184293378 22:43509631-43509653 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293430 22:43509796-43509818 ATGGATGGATGGAAAGAGGGAGG - Intergenic
1184318084 22:43714331-43714353 AAGGAAGGATAGAAGGAGGAAGG + Intronic
1184389421 22:44194774-44194796 ATGGATGGATAGATGATGGATGG - Intronic
1184410416 22:44323022-44323044 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410476 22:44323254-44323276 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410502 22:44323362-44323384 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410543 22:44323556-44323578 GTGGATGGATGGATGGTGGATGG - Intergenic
1184444555 22:44539712-44539734 GTGGATGGATGGATGGATGATGG + Intergenic
1184460828 22:44636923-44636945 GTGGATGGATAGATGGATGATGG + Intergenic
1184460850 22:44637030-44637052 GTGAATGGATAGATGGATGATGG + Intergenic
1184460873 22:44637129-44637151 GTGAATGGATAGATGGATGATGG + Intergenic
1184460906 22:44637272-44637294 GTGGATGGATAGGTGGATGATGG + Intergenic
1184676355 22:46045335-46045357 TTGGCTGGAGGGAAGGAGGAGGG + Intergenic
1184878118 22:47288368-47288390 AGGGATGGATGGAAGGATGAAGG - Intergenic
1184880738 22:47302849-47302871 ATGGATGAATAGAAGGTAGACGG - Intergenic
1184892036 22:47386022-47386044 CTGGATGAATAAATGAAGGAAGG - Intergenic
1184930765 22:47679633-47679655 ATGGATGGATGGATGGATGATGG - Intergenic
1184930769 22:47679652-47679674 ATGGATGGATGGATGGATGATGG - Intergenic
1184996775 22:48212978-48213000 ATGGATGGATGGATGGATGATGG - Intergenic
1185018769 22:48360987-48361009 ATGGATGGATGGAAGCTGGATGG + Intergenic
1185018785 22:48361099-48361121 ATGGATGGATAGATGATGGATGG + Intergenic
1185018845 22:48361662-48361684 ATGGATGGATAGATGATGGATGG + Intergenic
1185053514 22:48566062-48566084 ATGGATGGATGGATGGATGATGG + Intronic
1185076692 22:48687024-48687046 ATGGATGGATTGATGGAGGATGG + Intronic
1185104366 22:48858946-48858968 ATGGATGGATAGATGATGGAGGG - Intergenic
1185104427 22:48859202-48859224 AGGGATGGATGGATGGAGGATGG - Intergenic
1185108605 22:48888127-48888149 GTGGATGGATGGATGGGGGATGG - Intergenic
1185179498 22:49350898-49350920 CTGGAGGGATAAAAGCAGTAAGG + Intergenic
1185196805 22:49476828-49476850 ATGGATGGATGGTAGGTGGATGG + Intronic
1185196810 22:49476847-49476869 ATGGATGGATGGATGGTGGATGG + Intronic
1185196815 22:49476870-49476892 ATGGATGGATGGATGGATGATGG + Intronic
1185196821 22:49476893-49476915 ATGGATGGATGGATGGTGGATGG + Intronic
1185196838 22:49476961-49476983 ATGGATAGATAGATGGTGGATGG + Intronic
1185196871 22:49477125-49477147 ATGGATGGATGGATGGTGGATGG + Intronic
1185196886 22:49477190-49477212 ATGGATGGATGGATGGTGGATGG + Intronic
1185196904 22:49477250-49477272 GTGGATGGATGGATGGTGGATGG + Intronic
1185196932 22:49477385-49477407 ATGGATGGATGGATGGTGGATGG + Intronic
1185196939 22:49477411-49477433 GTGGATGGATGGATGGTGGATGG + Intronic
1185196952 22:49477460-49477482 ATGGATGGATGGATGGTGGATGG + Intronic
1185196969 22:49477521-49477543 TTGGATGGATGGATGGTGGATGG + Intronic
1185196980 22:49477563-49477585 TTGGATGGATGGATGGTGGATGG + Intronic
1185196988 22:49477593-49477615 ATGGATGGATGGATGGTGGATGG + Intronic
1185196996 22:49477630-49477652 ATGGATGGATGGATGGATGATGG + Intronic
1185197001 22:49477649-49477671 ATGGATGGATGGATGGTGGATGG + Intronic
1185197036 22:49477771-49477793 ATGGATGGATGGATGGTGGATGG + Intronic
1185197042 22:49477794-49477816 ATGGATGGATGGATGGTGGATGG + Intronic
1185197048 22:49477817-49477839 ATGGATGGATGGATGGTGGATGG + Intronic
1203226270 22_KI270731v1_random:80144-80166 ATGAATGGATAGAGGGAGGGAGG - Intergenic
1203264558 22_KI270734v1_random:6642-6664 ATGAATGGATAGAGGGAGGGAGG + Intergenic
949845201 3:8362643-8362665 CTAGATGGATGGATGGAGGATGG + Intergenic
950474196 3:13205512-13205534 GTGGATGGATAGAGGGAGGGAGG - Intergenic
950948719 3:16977464-16977486 CTGAATGGATTAAAAGAGGAAGG - Intronic
951760975 3:26147178-26147200 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
952038281 3:29230770-29230792 ATGGATGGAAGGAAGGAGGGAGG - Intergenic
952069506 3:29617061-29617083 ATAGATGGATGAAAGGAGGAAGG + Intronic
952245035 3:31578689-31578711 CTGCATGCATGGAAGGAGAAAGG - Intronic
952819185 3:37471247-37471269 CTTGTTGGAGAGAAGGAGGGAGG - Intronic
953038096 3:39230699-39230721 CTGGAAGGATAGAAGGATAAAGG - Intergenic
953546669 3:43868678-43868700 CTGGAAGGGTCAAAGGAGGAGGG + Intergenic
953827907 3:46270207-46270229 CTGGATGCATAGGTAGAGGAGGG - Intergenic
953902418 3:46850705-46850727 ATGGATGGATGGAGGGAGGGAGG + Intergenic
953983434 3:47424270-47424292 CTGGATGGCTAGAGACAGGATGG - Intronic
954060659 3:48063986-48064008 CTGGGAGGTTAGAAGCAGGATGG - Intronic
954354244 3:50071751-50071773 CTGGATAGCTAGGAGGAGAAGGG + Intronic
954753945 3:52828915-52828937 CTGGATGGAGGGAAGGACGGGGG + Intronic
955029746 3:55204774-55204796 ATGGATAGAGGGAAGGAGGAGGG - Intergenic
955380680 3:58435425-58435447 CTGGATGGATAGATGGGGTAAGG + Intergenic
956069754 3:65435488-65435510 ATGGATGGATGGATGGAAGATGG + Intronic
956069755 3:65435492-65435514 ATGGATGGATGGAAGATGGATGG + Intronic
956112596 3:65884733-65884755 GGGGATGGAGAGATGGAGGAAGG - Intronic
956241428 3:67134991-67135013 AAGGATGGATAGAGGGAGGCAGG - Intergenic
956748321 3:72327129-72327151 GTGGTTGAATAGATGGAGGATGG - Intergenic
956796346 3:72722130-72722152 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
956891035 3:73614330-73614352 CTGGATGGTTTGGAGGAGAATGG - Intronic
958466598 3:94467528-94467550 CAGGATAGAAAGAAGGATGAAGG + Intergenic
958700787 3:97586691-97586713 ATGGATGGATAGATGATGGATGG + Intronic
958717985 3:97809812-97809834 ATGGAAGGAAGGAAGGAGGAAGG + Intergenic
958813610 3:98891794-98891816 CTAGGTGGATAAAAGGAGGAGGG - Intronic
958989990 3:100831705-100831727 CTGGATGAGTAGAGGGATGAGGG - Intronic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
959903908 3:111689690-111689712 GTGGAGGGAAAGAAGAAGGAGGG + Intronic
959921783 3:111876202-111876224 ATTGATGGATAAAATGAGGAAGG + Intronic
960367728 3:116794155-116794177 ATGGATGGATGGATGGATGAAGG + Intronic
961084126 3:124052013-124052035 CTGAATGGATAGCAGGTGGGGGG + Intergenic
961149446 3:124624688-124624710 GTAGATAGATAGAAGGAGGCAGG + Intronic
961554099 3:127685782-127685804 AGGGATGGAAAGAGGGAGGAAGG - Intergenic
961740761 3:129031964-129031986 CTGGGTGGAGAGGAAGAGGAGGG + Intronic
962015392 3:131434274-131434296 AAGGATGGATGGAAGGAAGAAGG + Intergenic
962246330 3:133797328-133797350 CTGGATTGATAGAGATAGGAAGG + Intronic
962748235 3:138413389-138413411 TTGGATGGTTTGGAGGAGGAGGG - Intergenic
963323210 3:143832491-143832513 TTGGATGGATAGAAGGAGTTAGG - Intronic
965211649 3:165797324-165797346 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
965348689 3:167585980-167586002 CTGGATGGATAGATGGAAGTCGG + Intronic
966273006 3:178131023-178131045 CTCGTAGGATGGAAGGAGGAAGG + Intergenic
966959137 3:184915978-184916000 AGGGAGGGATAGAAGGAGGGAGG - Intronic
967446955 3:189578043-189578065 CTGAAGGGAAAGTAGGAGGAAGG - Intergenic
967768773 3:193311546-193311568 GGGGAGGGAAAGAAGGAGGAAGG + Intronic
967860618 3:194148671-194148693 GTGCATGGGTAGAAGGAGGTGGG - Intergenic
968594574 4:1475729-1475751 ATGAATGGATGGAAGGATGATGG + Intergenic
968598367 4:1496901-1496923 ATGGATGGATAGGTAGAGGATGG + Intergenic
968598390 4:1497041-1497063 CTGGATGGATAATGGGTGGATGG + Intergenic
968771023 4:2507186-2507208 CTGGAAGGAAGGAAGGAAGAGGG + Intronic
968931178 4:3580322-3580344 ATGGTTGGATGGATGGAGGATGG - Intronic
968931215 4:3580482-3580504 ATGGATGGATGGATGGAGGATGG - Intronic
969088628 4:4675432-4675454 ATGGGTGGATAGATGGATGATGG - Intergenic
969227276 4:5807240-5807262 GTGGATGGATGGAGGGAGGGAGG + Intronic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
969424823 4:7118068-7118090 GTGGATGGATAGATGGAGGAAGG + Intergenic
969424929 4:7118593-7118615 GTGGATGGATGGATGGATGATGG + Intergenic
969507056 4:7594602-7594624 AGGGAGGGAGAGAAGGAGGAAGG - Intronic
969510739 4:7616392-7616414 ATGGATGGATAGATGGATTATGG - Intronic
969514939 4:7641922-7641944 ATGGATGGATAGATGATGGATGG + Intronic
969523049 4:7689924-7689946 GTGAATGGATGGATGGAGGATGG + Intronic
969551269 4:7869211-7869233 ATGGATGGAGGGAAGGAGGAAGG + Intronic
969599369 4:8166902-8166924 ATGGATGGATGGTAGGTGGATGG - Intergenic
969612229 4:8233813-8233835 ATGGATGGATGGACGGATGATGG - Intronic
969960841 4:10943547-10943569 CAGGAGGGGTAGAAGGAAGAGGG - Intergenic
969991512 4:11268789-11268811 CAGGATGGAAAGAAGGGGTAGGG - Intergenic
970970276 4:21975349-21975371 CTGAATGGATGGAAGCAGTAAGG + Intergenic
971127399 4:23769385-23769407 ATGGATGGATGGATGGATGATGG - Intronic
971425012 4:26507489-26507511 ATGGATGGATGGAAGAAGGATGG + Intergenic
971642707 4:29156449-29156471 CTGATTGAATAGAAAGAGGATGG + Intergenic
971865169 4:32160513-32160535 AAGGAAGGAGAGAAGGAGGAAGG - Intergenic
972339331 4:38137405-38137427 CTGGAAGGAGAGAAGGAAGCGGG + Exonic
972570122 4:40303100-40303122 CAGGAAGGAGAGAAGGAGGCCGG + Intergenic
975197354 4:71541365-71541387 CTGGATGGTGTGAAGGAAGAAGG + Intronic
975237724 4:72019727-72019749 CTGTATTGAATGAAGGAGGAAGG + Intergenic
975497856 4:75054327-75054349 ATGGATGTTCAGAAGGAGGATGG - Intergenic
976075547 4:81295227-81295249 ATGGATGGATGGATGGATGATGG + Intergenic
976892854 4:90071596-90071618 GTGGATGGAGAAAGGGAGGATGG - Intergenic
977978703 4:103297389-103297411 CTGGATGGAGGGTGGGAGGAGGG - Intergenic
978240872 4:106514856-106514878 ATGGATAGATAGATGGATGATGG + Intergenic
978449242 4:108812736-108812758 ATGGTTGGATCGTAGGAGGAAGG + Intronic
978693795 4:111550447-111550469 GAGGATGGAGAGTAGGAGGAGGG + Intergenic
979600887 4:122585759-122585781 CTAGATGGATGGATGGAGCATGG + Intergenic
980418161 4:132520540-132520562 CTGGTAGTATAGAAGGAGTAGGG + Intergenic
980670009 4:135993434-135993456 GTGGATGGAAAGAAGAAGGAAGG - Intergenic
980871876 4:138621525-138621547 CTTGATGGTTAGAAGCAAGATGG - Intergenic
981676636 4:147350366-147350388 ATGGATGGAGGGAGGGAGGAAGG + Intergenic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
982585383 4:157230594-157230616 ATGGATGGAGGGAAGGAAGAAGG - Intronic
984716106 4:182926729-182926751 TAGGGTGGATAGCAGGAGGAGGG - Intergenic
984756892 4:183332936-183332958 GTGGATGGATGGATGGATGATGG - Intergenic
985074522 4:186200333-186200355 TTGGATGGATAAAAGAATGAAGG - Intronic
985111514 4:186551559-186551581 ATGGATGGATGGACGGACGATGG + Intronic
985446529 4:190023825-190023847 AGGGAGGGAGAGAAGGAGGAGGG - Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985529747 5:426937-426959 CTGGATGGATGGGAAGATGATGG + Intronic
985547612 5:517901-517923 ATGGATGGATGGATGGATGATGG - Intronic
985703644 5:1388340-1388362 GTGGATGGATAGATGGATGGAGG - Intergenic
985703779 5:1389056-1389078 ATGGATGGACAGAAGAAGGGAGG - Intergenic
985703781 5:1389060-1389082 CTGGATGGATGGACAGAAGAAGG - Intergenic
985709173 5:1418704-1418726 ATGGATGGATGGATGGATGATGG - Intronic
985709183 5:1418739-1418761 ATGGATGGATGGATGGATGATGG - Intronic
986072880 5:4304434-4304456 CTGGATGAATAGATGGATGATGG - Intergenic
986309192 5:6539165-6539187 ATTGATGGATAGATGGATGAAGG + Intergenic
986729364 5:10623806-10623828 CTGGGTGGACAGGAGGAGGCGGG + Intronic
986879040 5:12147657-12147679 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
986879048 5:12147681-12147703 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
987388268 5:17351081-17351103 GTGGAAGGTTAGAAGGAAGAAGG - Intergenic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
987549014 5:19353820-19353842 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
988893354 5:35644683-35644705 CAGGATGGAGAAAAGGAGCAGGG - Intronic
989427363 5:41312409-41312431 CTTGAAGGAAAGAAAGAGGAAGG - Exonic
989814935 5:45724462-45724484 ATGGAGGGAGAGAGGGAGGAGGG - Intergenic
992013029 5:72549593-72549615 CTGGATGGATGGATGGATGGAGG + Intergenic
992462086 5:76970534-76970556 ATGGATGGATGGATGGATGACGG + Intronic
992506993 5:77396624-77396646 CTAGATGGATAGAAAGGGAAAGG - Intronic
992552588 5:77873361-77873383 AAGGAAGGAAAGAAGGAGGAAGG - Intergenic
993622386 5:90184016-90184038 CATGAAGGAAAGAAGGAGGAAGG + Intergenic
995838119 5:116418196-116418218 ATGGATGGCTAAAAGGAGAAGGG + Intergenic
996784595 5:127224688-127224710 CTGAATGGGTTGGAGGAGGAAGG + Intergenic
997233703 5:132260520-132260542 CTGGAGAGAAAGAAGAAGGAAGG - Intronic
997339067 5:133128371-133128393 CTGGATGGATAGGTGGATGGTGG + Intergenic
997639938 5:135442546-135442568 CTGTAAGGATGGAGGGAGGAGGG - Intergenic
997654462 5:135544940-135544962 CTGGAAGGATAGGAGGGGCAAGG + Intergenic
997835783 5:137192301-137192323 CTGCATGGAGAGACGGAGGGAGG + Intronic
999410723 5:151347506-151347528 CTGGAAGGAGGGAAGCAGGAAGG + Exonic
999524166 5:152384212-152384234 ATGGATAGATAGATGGATGATGG - Intergenic
999726339 5:154441361-154441383 ATGGATGGATAGATGGATGATGG - Intergenic
999746733 5:154598135-154598157 TTGGATGGATGGATGGGGGATGG + Intergenic
1000332852 5:160219526-160219548 ATGGGTGGATGGAAGGTGGAGGG + Intronic
1000397261 5:160788834-160788856 GTGGATGGATGGATGGTGGATGG - Intronic
1000948381 5:167450047-167450069 ATGGATGGATGGATGGATGATGG + Intronic
1000982603 5:167832581-167832603 GTGGATGGATGGATGGAGGCAGG + Intronic
1001278400 5:170367518-170367540 ATGGATGGATTGATGGAGGATGG + Intronic
1001421442 5:171590246-171590268 ATGGATGGACAGATGAAGGATGG - Intergenic
1001435457 5:171695939-171695961 ATGGATGGATGGATGGATGATGG + Intergenic
1001543443 5:172555151-172555173 CTGGATGAATGAATGGAGGAGGG - Intergenic
1001569102 5:172718556-172718578 GTGGATGGATAGAAGTCGAATGG + Intergenic
1001686351 5:173597580-173597602 ATGGAGGGAAAGAAGGAGGGAGG - Intergenic
1001686408 5:173597744-173597766 ATGGATGGATGGAGGGAGGGAGG - Intergenic
1001686475 5:173597920-173597942 ATGGATGGATGGAGGGAGGGAGG - Intergenic
1001686511 5:173598012-173598034 ATGGATGGATGGAGGGAGGGAGG - Intergenic
1001686513 5:173598016-173598038 ATGGATGGATGGATGGAGGGAGG - Intergenic
1001701737 5:173711741-173711763 ATGGATGGATGGATGGATGATGG + Intergenic
1001724457 5:173885392-173885414 CTGGAAGTATGGAAGAAGGAAGG - Intergenic
1001751435 5:174134546-174134568 ATGGATGGATGGATGGATGATGG - Intronic
1001751483 5:174134820-174134842 ATGGATGGATGGATGGATGATGG - Intronic
1001865670 5:175102964-175102986 CTGGATGGATGGATGAATGATGG + Intergenic
1001865677 5:175103022-175103044 ATGAATGGATAGATGGATGATGG + Intergenic
1002079459 5:176728739-176728761 CGGGATGGAGAGAAGAAGGCAGG + Intergenic
1002270221 5:178066942-178066964 GTGGAAGGAGGGAAGGAGGATGG + Intergenic
1002303300 5:178269547-178269569 ATGGATGGATGGATGGATGATGG - Intronic
1002341595 5:178519819-178519841 ATGGACAGATAGATGGAGGATGG + Intronic
1002341632 5:178520069-178520091 ATGGATGGATAGATGGAGGATGG + Intronic
1002439099 5:179255001-179255023 ATGGATGGATGGATGGATGATGG + Intronic
1002453231 5:179331395-179331417 CTGGAGGGAGAGGAGGGGGAAGG + Intronic
1002559190 5:180070076-180070098 GTGGAAGGGTAGAAAGAGGAAGG - Intronic
1002563926 5:180099691-180099713 CAGGATGGGTATCAGGAGGATGG - Intergenic
1003273687 6:4629706-4629728 CTGGGTGGCTTGTAGGAGGAAGG + Intergenic
1003298133 6:4852393-4852415 TTGGAAGGAAGGAAGGAGGAAGG - Intronic
1003519232 6:6843421-6843443 CTGGATGGAGAGGTGGAGGGTGG - Intergenic
1003666089 6:8112617-8112639 CAGGATGAATTGGAGGAGGAAGG - Intergenic
1003941777 6:11035434-11035456 AAGGATGGATAGAAGGAGCATGG - Intronic
1004585908 6:17000129-17000151 CTGGTTGGATGGATGGATGAAGG - Intergenic
1004816746 6:19319308-19319330 ATGGAAGGAAAGAAGGAAGAAGG - Intergenic
1004820324 6:19361106-19361128 TTGGATGCAGAGAATGAGGAAGG - Intergenic
1005030240 6:21501481-21501503 CTGTATGCAAAGAAGGAAGATGG - Intergenic
1005395682 6:25379457-25379479 TTGGATAGATGGAAGAAGGAGGG + Intronic
1005639180 6:27778524-27778546 CTGTAAGTATGGAAGGAGGAGGG - Intergenic
1005885931 6:30097765-30097787 TAAGATGGATAGAAGGATGAAGG + Intergenic
1005989657 6:30895115-30895137 ATAGATGGATAGATGGATGATGG - Intronic
1006277868 6:33020680-33020702 CTGGATGGATAGGGTCAGGAAGG - Intergenic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1006832919 6:36979648-36979670 CTGGAAGGAGAGGAGGAGGAGGG + Intronic
1007234573 6:40381213-40381235 CTGGATGGAGAGGAGGAATAAGG - Intergenic
1007275841 6:40673050-40673072 AGGGATGGAGAGAAGGAGAAAGG - Intergenic
1007406418 6:41638451-41638473 CTGGAGGGAGAGAAGGAAGAAGG + Exonic
1007692328 6:43710586-43710608 GTGGAAGGAAAGGAGGAGGAAGG + Intergenic
1007783246 6:44265800-44265822 ATGAATGGAGTGAAGGAGGAAGG - Intergenic
1007915132 6:45554321-45554343 CTGAAGGGAGGGAAGGAGGAGGG + Intronic
1008501930 6:52191703-52191725 CTGGAGGGATAGCAGGGGGAAGG - Intergenic
1009948359 6:70366066-70366088 AAGGAGGGATAGAGGGAGGAAGG + Intergenic
1010704307 6:79089680-79089702 ATGGAGGGAAAGAGGGAGGAAGG - Intergenic
1011410503 6:87061312-87061334 GTGGAAGGTGAGAAGGAGGAGGG + Intergenic
1011507014 6:88056428-88056450 ATGGAAGGATGGAAGGAAGAAGG - Intronic
1012512201 6:100014831-100014853 CAGGCTGGAGAGAAAGAGGAGGG + Intergenic
1012515048 6:100049512-100049534 ATGGATGGATGGAGGGAAGAGGG + Intergenic
1012603668 6:101130889-101130911 CTGGGTGGCAAGAAGGGGGAAGG + Intergenic
1012906273 6:105069976-105069998 GTGGAAGGAGGGAAGGAGGAAGG - Intronic
1014273156 6:119356743-119356765 CTGGAGGGATAGGAGGATGGAGG + Intergenic
1014351355 6:120350049-120350071 CTGGATGAAGAGCAAGAGGAGGG + Intergenic
1014775493 6:125504350-125504372 TAGGATGGATAGAAGCAAGATGG - Intergenic
1014888768 6:126816148-126816170 ATGGAAGGAAAGAAAGAGGAAGG - Intergenic
1015121739 6:129708022-129708044 GGGGATGGATAGAAGGAAGGAGG - Intronic
1016317659 6:142808317-142808339 ATGGATGGAAGGAAGGAGGGAGG + Intronic
1016317776 6:142808776-142808798 ATGAATGGATGGAGGGAGGAAGG + Intronic
1018239710 6:161761319-161761341 GTGGATGGATGGATGGATGATGG + Intronic
1018853066 6:167655061-167655083 ATGGATGGATGGATGGATGATGG + Intergenic
1019095375 6:169575285-169575307 ATGGATGGAGAGAGGGAGGGAGG - Intronic
1019327023 7:443520-443542 ATGGATGGATGGATGGTGGATGG + Intergenic
1019327048 7:443633-443655 GTGGATGGATGGATGGTGGATGG + Intergenic
1019335977 7:483055-483077 ATGGATGGATAGAAGATGGATGG + Intergenic
1019345620 7:528871-528893 ATGGATGGATAGATGATGGATGG + Intergenic
1019479979 7:1261893-1261915 ATGGATAGATAGATGGATGATGG - Intergenic
1019503692 7:1379584-1379606 ATGGATGGATGGATGGATGATGG + Intergenic
1019510810 7:1416372-1416394 ATGGATGGATGGATGGAGGATGG + Intergenic
1019549614 7:1595416-1595438 GAGGATGGATGGAGGGAGGATGG - Intergenic
1019704490 7:2491068-2491090 ATGGATGGATGGATGGGGGATGG - Intergenic
1019704562 7:2491351-2491373 ATGGATGGATGGATGGGGGATGG - Intergenic
1019704598 7:2491469-2491491 ATGGATGGATGGATGGATGATGG - Intergenic
1019704710 7:2491993-2492015 CTGGATGGAGAGATGGATGGTGG - Intergenic
1019914668 7:4125069-4125091 ATGGATGGATGGATGGATGATGG + Intronic
1019914698 7:4125215-4125237 GTAGATGGATAGATGGATGATGG + Intronic
1020731139 7:11882442-11882464 AAGGATGGAGAGAAGGAGAAGGG - Intergenic
1021595700 7:22314233-22314255 CTGGCTGAAGAGAAGCAGGAAGG + Intronic
1022216061 7:28262787-28262809 AAGGAAGGAAAGAAGGAGGAGGG - Intergenic
1022477237 7:30719598-30719620 ATGGATGGATGGATGGATGATGG - Intronic
1022749105 7:33204596-33204618 CTGAATGAAGAGTAGGAGGAAGG - Intronic
1023239408 7:38127791-38127813 CTGGATGGAGGGAAGGAAGGAGG - Intergenic
1023565705 7:41522006-41522028 AGGGAGGGAGAGAAGGAGGAAGG + Intergenic
1023636822 7:42220379-42220401 ATGGATGGACAGAAGGATGGAGG + Intronic
1023754959 7:43407794-43407816 ATGAATGGAGGGAAGGAGGAGGG - Intronic
1023856043 7:44184778-44184800 GTAGAAGGATAGAAGGATGAGGG - Intronic
1024373900 7:48617283-48617305 AGGGATGGAGAGGAGGAGGAAGG - Intronic
1024512380 7:50213901-50213923 ATGGATGGGTTGTAGGAGGAGGG - Intergenic
1025606872 7:63045768-63045790 GTGGATGGATAGATGATGGATGG - Intergenic
1026023738 7:66729467-66729489 GAGGATGGAGAGCAGGAGGAAGG - Intronic
1026080140 7:67210667-67210689 ATGGATGGATAGACAGATGACGG - Intronic
1026203538 7:68235740-68235762 ATGAATGGATGGAAGGTGGATGG + Intergenic
1026275188 7:68870217-68870239 ATGGATGGATAGATGGATGATGG + Intergenic
1026275208 7:68870337-68870359 CTGGATGGATGGATGGATGATGG + Intergenic
1026275397 7:68871784-68871806 ATGGATAGATAGACGGATGATGG - Intergenic
1026319638 7:69257610-69257632 ATGGATGGATGGATGGATGACGG + Intergenic
1026330471 7:69347915-69347937 GAGGATGGAGAGTAGGAGGAGGG + Intergenic
1026531329 7:71199802-71199824 TTGGATGGATGGATGGATGATGG - Intronic
1026605910 7:71815747-71815769 AGGGAAGGAAAGAAGGAGGAAGG - Intronic
1026828605 7:73598365-73598387 GTGGATGGATGGAAGGATTATGG - Intronic
1026903439 7:74049470-74049492 ATAGATGGATAGATGGTGGATGG - Intronic
1026930762 7:74221810-74221832 TTGGGTGGACAGAAGGAGGCTGG + Intronic
1026964561 7:74431009-74431031 ATGGATGGATGAAGGGAGGAGGG - Intergenic
1027163760 7:75820665-75820687 GTGGATGGATGGATGGATGATGG - Intronic
1027163768 7:75820704-75820726 GTGGATGGGTAGATGGATGAAGG - Intronic
1027252751 7:76409487-76409509 CTGGAAGTTTAGGAGGAGGAAGG + Exonic
1028138992 7:87251640-87251662 CTGGATGGATATATGAAGAAAGG - Intergenic
1028305427 7:89257757-89257779 CTTGATGGAGAGTTGGAGGAAGG - Intronic
1029599728 7:101556647-101556669 ATGGATGGATGGATGGATGATGG + Intronic
1029599839 7:101557347-101557369 CTGGAAGGAGAGCAGGAGGGTGG - Intronic
1029604804 7:101592117-101592139 ATGGATGGATGGATGGAGGGAGG - Intergenic
1029604861 7:101592455-101592477 ATGGATGGATGGATGGATGATGG - Intergenic
1029664833 7:101988514-101988536 CTGGAGGGAAAGGAGGAGCAGGG - Intronic
1030075635 7:105733929-105733951 ATGGATGGATGGATGGATGATGG - Intronic
1030745537 7:113161094-113161116 CTGGAATGGTAGAATGAGGATGG - Intergenic
1030769258 7:113453950-113453972 CTGGATGGGTAAAAGTGGGAAGG - Intergenic
1030778572 7:113567971-113567993 GTGCATGGATATGAGGAGGAGGG + Intergenic
1031386365 7:121156679-121156701 CAGAAATGATAGAAGGAGGATGG + Intronic
1031489181 7:122366759-122366781 CTGGATTCACAGAAAGAGGATGG - Intronic
1031505065 7:122572307-122572329 CTGAAAGGATTTAAGGAGGAAGG - Intronic
1031564194 7:123274650-123274672 CTGAATGGGCACAAGGAGGAAGG - Intergenic
1031922588 7:127612751-127612773 ATGGATGGATGAATGGAGGATGG + Intronic
1032725169 7:134584354-134584376 ATGGATGGATGGAGGGAGGGTGG + Intergenic
1032725206 7:134584528-134584550 AAGGATGGATAGATGGAGGGAGG + Intergenic
1032841768 7:135719865-135719887 ATAGATAGATAGAAAGAGGAAGG + Intronic
1032996115 7:137448556-137448578 AGGGAGGGAGAGAAGGAGGAGGG + Intronic
1033137652 7:138798249-138798271 TGGGAGGGAAAGAAGGAGGAGGG + Intronic
1033234172 7:139625105-139625127 TTGGAAGGATAGATGGACGAGGG - Intronic
1034422236 7:150996065-150996087 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034422264 7:150996131-150996153 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034536325 7:151728038-151728060 CTGGAGGGATCCACGGAGGACGG - Intronic
1035111840 7:156489150-156489172 GTGGATGGATGGAAGGATGGAGG + Intergenic
1035278853 7:157765005-157765027 ATGGATGGATGGAAGAATGATGG - Intronic
1035278884 7:157765135-157765157 ATGGATGGATGGATGAAGGATGG - Intronic
1035278888 7:157765154-157765176 TTGGATGGATAAAAGAAGGATGG - Intronic
1035279089 7:157766047-157766069 ATGGATGGATGGATGGAGGAAGG - Intronic
1035279133 7:157766243-157766265 ATGGATGGATGGAGGAAGGATGG - Intronic
1035279134 7:157766247-157766269 AAGGATGGATGGATGGAGGAAGG - Intronic
1035279151 7:157766328-157766350 ATGGATGGATGGATGAAGGAAGG - Intronic
1035279155 7:157766347-157766369 ATGGATGGGTAGATGGATGATGG - Intronic
1035279180 7:157766473-157766495 ATGGATGGATGGAGGAAGGATGG - Intronic
1036457203 8:8920217-8920239 ATGGATGGATGGAGGGAGGGAGG + Intergenic
1036623630 8:10446020-10446042 CTGGAAGGATGGAGGGAGGTGGG + Intergenic
1036765534 8:11547456-11547478 CTGGATGGAAGGCAGGAAGAGGG - Intronic
1037020842 8:13968381-13968403 CTGGATGGAATGAAGAAGCAGGG - Intergenic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1037498445 8:19462966-19462988 CAGGGTGGAGAGTAGGAGGAGGG - Intronic
1037586570 8:20280777-20280799 CTGGCTGGATCTAAGGAGGAAGG - Intronic
1037598690 8:20375276-20375298 ATGGATGGATGGATGGTGGATGG - Intergenic
1037669733 8:21004051-21004073 ATAGATGGATAGATGGAGGATGG + Intergenic
1038087691 8:24218029-24218051 GTGGAGAGATGGAAGGAGGAAGG + Intergenic
1038325130 8:26567235-26567257 GTGGATGGATAGATGGATGATGG - Intronic
1038440769 8:27569564-27569586 ATGGATGGATGGATGGATGAAGG + Intergenic
1038440910 8:27570180-27570202 ATGGATGGATGGATGGATGAAGG + Intergenic
1038820907 8:30951169-30951191 AAGGAAGGATGGAAGGAGGAAGG - Intergenic
1038896888 8:31793882-31793904 ATGGAGAGATGGAAGGAGGAAGG - Intronic
1039644188 8:39262612-39262634 AGGGATGGAGGGAAGGAGGAAGG - Intronic
1040584392 8:48726256-48726278 ATGGATGGATAGATAGATGATGG - Intronic
1041010257 8:53534936-53534958 ATGGATGGATGGATGGATGATGG + Intergenic
1041063326 8:54057659-54057681 CTGGAAGGGTAGAAGGGGGCTGG + Intronic
1041866565 8:62581728-62581750 ATGGATGGAGGGAGGGAGGAAGG - Intronic
1042108842 8:65357357-65357379 CTTGATAGAAAGAAGGAGAAGGG - Intergenic
1042215343 8:66425437-66425459 ATGGATGGATGGATGGATGAAGG + Intergenic
1042502716 8:69526851-69526873 AAGGAAGGAAAGAAGGAGGAAGG + Intronic
1043324879 8:79037546-79037568 CTGGCTGCATAGAATGAGTAAGG - Intergenic
1044428608 8:92082889-92082911 GAGGAGGGAGAGAAGGAGGAGGG + Intronic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044808296 8:96031224-96031246 CTGGCTGGAGAGAAGGGGTAGGG - Intergenic
1046112171 8:109738478-109738500 ATGGATGGATGGATGGATGAGGG - Intergenic
1047241882 8:123098279-123098301 CTGGAAGAATAGAAGGTGCAAGG - Intronic
1047306781 8:123659075-123659097 ATGGATGGATAGATGGATGATGG - Intergenic
1047306790 8:123659124-123659146 GTGGGTGGATAGATGGATGATGG - Intergenic
1047306802 8:123659191-123659213 ATGGATGGATAGATGGATGATGG - Intergenic
1047306808 8:123659225-123659247 ATGGATGGATTGGTGGAGGATGG - Intergenic
1047306814 8:123659248-123659270 ATGGATGGATAGATGATGGATGG - Intergenic
1047306844 8:123659401-123659423 ATGGATGGATAGATGGATGGAGG - Intergenic
1047306854 8:123659453-123659475 GTGGATGGATAGATGATGGATGG - Intergenic
1047306881 8:123659605-123659627 ATGGATGGATAGATGATGGATGG - Intergenic
1047306897 8:123659744-123659766 ATGGATGGATGGATGGATGATGG - Intergenic
1047312737 8:123706317-123706339 CTGAATGGAAAGAAAGAGGTAGG - Intronic
1047322261 8:123797808-123797830 CTGGATGGAGAGAGGAAGTACGG + Intronic
1048059987 8:130909033-130909055 ATGGATGGATGGATGGTGGATGG - Intronic
1048187873 8:132260877-132260899 TTGGATGGATGGATGGATGATGG - Intronic
1048232173 8:132653206-132653228 ATGGATGGATAGATGGAAGAAGG + Intronic
1048232174 8:132653210-132653232 ATGGATAGATGGAAGAAGGAAGG + Intronic
1048297048 8:133222117-133222139 ATGGATGGATGGATGGAGGATGG + Intronic
1048710233 8:137201626-137201648 ATGGGTGGATAGAAGGATGTTGG + Intergenic
1048748984 8:137649610-137649632 GGAGATGGAAAGAAGGAGGAAGG + Intergenic
1048979739 8:139696917-139696939 GTGGATGGATAGATGGATGAAGG + Intronic
1048979835 8:139697297-139697319 GTGGATGGATAGATGGTGGGTGG + Intronic
1048989246 8:139751707-139751729 CTGGATGGATGGATGGTAGATGG - Intronic
1048989500 8:139752987-139753009 ATGGATGGGTAGAAGTTGGATGG - Intronic
1048989541 8:139753155-139753177 ATGGATGGATGGATGGTGGATGG - Intronic
1049008861 8:139874290-139874312 TTGGACCGATAGGAGGAGGATGG + Intronic
1049042181 8:140120835-140120857 ATGGATGGATGGATGGATGATGG - Intronic
1049155280 8:141062486-141062508 CTGGATGGAGAGAGGATGGAAGG + Intergenic
1049348313 8:142150734-142150756 ATGGATGGATGGATGGACGATGG + Intergenic
1049350664 8:142162831-142162853 GAGGATGGATGGATGGAGGATGG + Intergenic
1049350698 8:142163007-142163029 ATTGATGTATAGATGGAGGATGG + Intergenic
1049350720 8:142163125-142163147 ATGGATGGATGGAAGGATGAAGG + Intergenic
1049350795 8:142163521-142163543 ATGGATGGATGGAAGGATGAAGG + Intergenic
1049350867 8:142163930-142163952 ATGGGTGGATGGATGGAGGATGG + Intergenic
1049350926 8:142164221-142164243 ATGGATGGATGGATGGATGAAGG + Intergenic
1049356681 8:142192655-142192677 CAGGAAGGAGGGAAGGAGGAGGG + Intergenic
1049359831 8:142207190-142207212 ATGGATGCATAGATGGGGGATGG + Intergenic
1049359964 8:142207692-142207714 ATGGATGAATAGATGGGGGATGG + Intergenic
1049364302 8:142229294-142229316 ATGGATGGATGGATGGTGGATGG + Intronic
1049371953 8:142272225-142272247 ATGGGTAGATGGAAGGAGGAAGG - Intronic
1049371973 8:142272301-142272323 GTGGATGGGTAGATGGAGGAAGG - Intronic
1049371983 8:142272337-142272359 GTGGGTGGATGGAAAGAGGAAGG - Intronic
1049371991 8:142272369-142272391 GTGGATGGATGGAAGGAGGAAGG - Intronic
1049372001 8:142272405-142272427 ATAGGTGGATGGAAGGAGGAAGG - Intronic
1049372011 8:142272445-142272467 ATGGGTGGATGGAAGGAGGAAGG - Intronic
1049372021 8:142272485-142272507 GTGGATGGATGGAAGAAGGAAGG - Intronic
1049372043 8:142272581-142272603 GTGGGTGGATGGAAGGAGGAAGG - Intronic
1049372052 8:142272613-142272635 GTGGATGGATGGAAGGAGGAAGG - Intronic
1049416110 8:142496102-142496124 CTGGATGTATAGATGGTAGATGG + Intronic
1049428499 8:142548509-142548531 GTGGATGGATGGATGGTGGATGG + Intergenic
1049464101 8:142743356-142743378 ATGGATGGATGGATGGGGGATGG + Intergenic
1049464417 8:142744451-142744473 ATGGGTGGATAGATGGGGGATGG + Intergenic
1049464629 8:142745148-142745170 AAGGATGGATGGATGGAGGATGG + Intergenic
1049464907 8:142746690-142746712 GTGGATAGATAGATGGGGGATGG + Intergenic
1049464985 8:142746985-142747007 GTGGATGGATGGATGGTGGATGG + Intergenic
1049474778 8:142791782-142791804 GAGGATGGATGGATGGAGGATGG - Intergenic
1049474794 8:142791872-142791894 GTGGGTGGATGGATGGAGGATGG - Intergenic
1049474876 8:142792436-142792458 GTGGATGGATGGATGGATGACGG - Intergenic
1049474881 8:142792463-142792485 ATGGATGGATGGAAGGTGAACGG - Intergenic
1049474899 8:142792572-142792594 GTGGGTGGATGGATGGAGGATGG - Intergenic
1049475936 8:142797012-142797034 ATGGATGGAGGGAGGGAGGAAGG + Intergenic
1050008868 9:1164299-1164321 ATGGAGGGAGGGAAGGAGGAAGG - Intergenic
1050458749 9:5858815-5858837 CTGGAAGGATGGATGGATGATGG + Intergenic
1050595352 9:7199456-7199478 CTGGATGGGCAGGAAGAGGAGGG + Intergenic
1051014924 9:12463061-12463083 GAGGAAGGAAAGAAGGAGGAAGG - Intergenic
1051709171 9:19912514-19912536 ATGGTTAGATAGATGGAGGAAGG - Intergenic
1052473612 9:28930689-28930711 AGGGAAGGATACAAGGAGGAAGG + Intergenic
1052617527 9:30860812-30860834 CTGGGTGGATAGATGGGTGATGG + Intergenic
1052617531 9:30860831-30860853 ATGGATGGATAGATGGATGGAGG + Intergenic
1052894332 9:33733245-33733267 CTGGATGGAGGTAAGGAGGCAGG + Intergenic
1053067354 9:35078078-35078100 CTGGAGAGAAAGGAGGAGGAAGG + Intronic
1053076993 9:35141660-35141682 GGGGATCGAGAGAAGGAGGATGG + Intergenic
1053198806 9:36138986-36139008 ATGGATGGAGAGAAGGTGGAGGG + Intronic
1053802979 9:41775744-41775766 ATGGATGGATGGATGGTGGATGG - Intergenic
1054142280 9:61539362-61539384 ATGGATGGATGGATGGTGGATGG + Intergenic
1054458884 9:65451342-65451364 ATGGATGGATGGATGGATGATGG + Intergenic
1054458905 9:65451432-65451454 ATGGATGGATGGATGGAGGATGG + Intergenic
1054458943 9:65451600-65451622 ATGGATGGATGGATGGAGGATGG + Intergenic
1054462029 9:65470513-65470535 ATGGATGGATGGATGGTGGATGG + Intergenic
1054799338 9:69331604-69331626 CTGGATGGAAAGAATGCTGATGG + Intronic
1054935828 9:70686742-70686764 AGGGAGGGAGAGAAGGAGGAAGG - Intronic
1055080089 9:72260134-72260156 CTGGATGGAAGGAAAGAGCATGG + Intergenic
1055193245 9:73553260-73553282 ATGGATGGAAGGAAGGAGGAAGG - Intergenic
1055417934 9:76104366-76104388 CTGGATGGAGTGGAGGAGAAAGG - Intronic
1056135482 9:83625918-83625940 ATGGATGGATGGATGGAAGACGG + Intronic
1056523173 9:87418826-87418848 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
1057008701 9:91583223-91583245 CTGGATGGATGGATGGAGGATGG + Intronic
1057297511 9:93858007-93858029 GTGGATGGATAGGTGGATGATGG + Intergenic
1058230883 9:102422898-102422920 CTGGATGGATCGATGGATGATGG - Intergenic
1058736647 9:107900008-107900030 TTGGCTGGATAGAAAGATGAGGG - Intergenic
1059409081 9:114120791-114120813 CTGGCTGGATAGATAGATGATGG + Intergenic
1059409082 9:114120795-114120817 CTGGATAGATAGATGATGGATGG + Intergenic
1059409111 9:114120969-114120991 ATGGATGGATGGATGGTGGATGG + Intergenic
1059416404 9:114165340-114165362 ATGGATGGATGGATGGATGATGG - Intronic
1059762759 9:117354688-117354710 CTGGAGGGAGGGAAGGAGGAGGG - Intronic
1059858949 9:118435288-118435310 ATGAATGGGTAGAAGGATGATGG - Intergenic
1060298952 9:122362820-122362842 CTGGATGGAGAGAAGGGGGAGGG - Intergenic
1060838390 9:126775572-126775594 CTGGATGGAGAGAAGCATGAAGG + Intergenic
1061244642 9:129395144-129395166 ATGGGAGGATAGATGGAGGATGG + Intergenic
1061244988 9:129397005-129397027 ATGGATGGAAGGATGGAGGATGG + Intergenic
1061245102 9:129397533-129397555 ATGGATGGGTAGATGGATGATGG + Intergenic
1061255583 9:129453153-129453175 ATGGAAGGATGGAAGGATGAAGG + Intergenic
1061256511 9:129456711-129456733 CTGGATGGATGGATGATGGATGG + Intergenic
1061256674 9:129457476-129457498 ATGGATGGATGGATGGATGATGG + Intergenic
1061416543 9:130450368-130450390 CAGGATGGAGGGAAGGAGGGAGG - Intronic
1061417446 9:130454783-130454805 ATGGATGGATGGATGGATGATGG - Intronic
1061417458 9:130454829-130454851 ATGGATGGATGGATGGATGATGG - Intronic
1061417483 9:130454945-130454967 ATAGATGGATAGATGGATGATGG - Intronic
1061417487 9:130454972-130454994 ATGGATGAATGGACGGAGGATGG - Intronic
1061417502 9:130455048-130455070 ATGGATGGATGGATGGATGATGG - Intronic
1061417511 9:130455094-130455116 ATGGATGGATAGACGGATGATGG - Intronic
1061417516 9:130455132-130455154 ATGGATGGATGGATGGATGATGG - Intronic
1061417534 9:130455250-130455272 ATGGATGGATAGATGATGGATGG - Intronic
1061417551 9:130455343-130455365 ATGGATGGATAGACAGTGGAGGG - Intronic
1061417559 9:130455394-130455416 ATGGATGGATGGATGGGGGATGG - Intronic
1061848259 9:133400286-133400308 GTGGGTGAATAGAAGGGGGAAGG - Intronic
1061911797 9:133728956-133728978 ATAGATGGAGAGATGGAGGACGG + Intronic
1061950533 9:133933543-133933565 ATGGATGGATGGATGGTGGATGG + Intronic
1061950538 9:133933562-133933584 ATGGATGGATGGATGGTGGATGG + Intronic
1061950597 9:133933828-133933850 ATGGATGGATGGATGGTGGATGG + Intronic
1061950616 9:133933902-133933924 GTGGATGGATGGATGGATGATGG + Intronic
1061950625 9:133933937-133933959 ATGGATGGATGGATGGTGGATGG + Intronic
1061963340 9:133999038-133999060 GTGGAGGGATAGATGGAGGGAGG - Intergenic
1061964066 9:134003373-134003395 GTGGATGGGTAGAGGGTGGATGG - Intergenic
1061980952 9:134103380-134103402 CTGGATGGATGGATGGTGGATGG - Intergenic
1061980970 9:134103458-134103480 GTGGATGGATGGATGGTGGATGG - Intergenic
1061981006 9:134103630-134103652 CTGGATGGATGGATGGATGGTGG - Intergenic
1061981010 9:134103645-134103667 CTGGATGGATGGATGCTGGATGG - Intergenic
1061981030 9:134103739-134103761 ATGGATGGATAGATGGATGCTGG - Intergenic
1061981049 9:134103827-134103849 CTGGATGGATAGATGAATGGTGG - Intergenic
1061981052 9:134103846-134103868 ATGGATGGATAGATGGATGCTGG - Intergenic
1061981081 9:134103991-134104013 GTGGATGGATGGATGGTGGATGG - Intergenic
1061981085 9:134104006-134104028 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981101 9:134104077-134104099 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981184 9:134104430-134104452 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981191 9:134104467-134104489 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981249 9:134104706-134104728 ATGGATGGATGGATGGTGGATGG - Intergenic
1062092308 9:134684890-134684912 GTGAATGGATAGATGGTGGATGG - Intronic
1062092341 9:134685049-134685071 ATGGATGGATGGATGGTGGATGG - Intronic
1062092395 9:134685286-134685308 GTGGATGGATGGATGGTGGATGG - Intronic
1062092430 9:134685445-134685467 ATGGATGGATGGATGGATGATGG - Intronic
1062092448 9:134685526-134685548 CTGGATGGATGGATGGTGGATGG - Intronic
1062092459 9:134685580-134685602 ATGGATGGATGGATGGAGGATGG - Intronic
1062092467 9:134685614-134685636 GTGGATGGATGGATGGTGGATGG - Intronic
1062092488 9:134685707-134685729 ATGGATGGATAGATGGATGATGG - Intronic
1062092506 9:134685793-134685815 ATGGATGGATAGATGGATGATGG - Intronic
1062092538 9:134685934-134685956 ATGGATGGATGGATGGTGGATGG - Intronic
1062103550 9:134740584-134740606 CTGGATGGATAGAAGGAGGACGG - Intronic
1062172226 9:135141240-135141262 ATGGATGGATGGATGGATGATGG + Intergenic
1062172241 9:135141350-135141372 ATGGATGGATAGATGAGGGATGG + Intergenic
1062172282 9:135141651-135141673 ATGGATGGATAGATGATGGATGG + Intergenic
1062172296 9:135141736-135141758 ATGGATGGATAGATGATGGATGG + Intergenic
1062172306 9:135141799-135141821 ATGGATGGATAGATGATGGATGG + Intergenic
1062201235 9:135303907-135303929 ATGGATGGATAAATGGAGGGTGG + Intergenic
1062201342 9:135304435-135304457 ATGAATGGATAGATGGATGATGG + Intergenic
1062239173 9:135526607-135526629 CTGGGTGGGAAGCAGGAGGAAGG + Intergenic
1062247967 9:135579329-135579351 ATGGGTGGATAGATGGTGGATGG - Intergenic
1062281326 9:135753106-135753128 ATGGATGGAGAGATGGATGATGG + Intronic
1062449099 9:136608137-136608159 AGGGAAGGAGAGAAGGAGGAGGG + Intergenic
1062449116 9:136608183-136608205 AGGGAAGGAGAGAAGGAGGAGGG + Intergenic
1062520696 9:136956669-136956691 ATGGATGGATGGATGGATGATGG + Intronic
1062649735 9:137569419-137569441 CTGGATGGATGGATGGTGGGTGG - Intronic
1185543743 X:925356-925378 ATGGATGGATGGATGGTGGATGG + Intergenic
1185543748 X:925375-925397 ATGGATGGATGGATGGTGGATGG + Intergenic
1185547110 X:954450-954472 CTGGATGAATGGATGGATGAGGG - Intergenic
1185592522 X:1286968-1286990 GAGAAAGGATAGAAGGAGGAGGG + Intronic
1185611416 X:1395598-1395620 ATGGATGGATGGATGGATGATGG + Intergenic
1185629963 X:1508678-1508700 ATGGATGGATGGATGGATGATGG - Intronic
1185630011 X:1509340-1509362 ATGGATGGATGGATGGATGATGG - Intronic
1185636733 X:1557611-1557633 ATGGATGAATAGAAGATGGATGG - Intergenic
1185639257 X:1577641-1577663 ATGGATGGATGGATGGATGATGG + Intergenic
1185694447 X:2184741-2184763 CTGGATAGATAGAAACAGGTGGG - Intergenic
1185744368 X:2560175-2560197 ATGGATGGATATATGGATGATGG + Intergenic
1185780599 X:2841432-2841454 ATGGATGGATGGATGGATGATGG + Intronic
1185837418 X:3358106-3358128 ATAGATGGATATATGGAGGATGG - Intergenic
1185867814 X:3639149-3639171 GTGGATGGATGGATGGATGAAGG + Intronic
1185867852 X:3639265-3639287 ATGGATGGATGGATGGATGAAGG + Intronic
1186055577 X:5646182-5646204 ATGGATGGATGGATGGATGATGG - Intergenic
1186178642 X:6951213-6951235 ATGGATGGATGGATGGATGATGG - Intergenic
1186246699 X:7622754-7622776 ATGGAAGGAGAGGAGGAGGAAGG - Intergenic
1186317536 X:8386973-8386995 GTGGAGGGATAGAGAGAGGAAGG + Intergenic
1186338992 X:8623013-8623035 CTGGATGGATGGATGGATGATGG + Intronic
1186748692 X:12598452-12598474 CTGGCAGGAGAGAATGAGGATGG - Intronic
1187307795 X:18112656-18112678 CTATATGGAAAGAAGGAAGAAGG - Intergenic
1187495846 X:19794845-19794867 CTGAATGAATGGAAGGAGTAAGG - Intronic
1187841589 X:23494357-23494379 CTTGAAGGTTAGAAGCAGGATGG + Intergenic
1188148236 X:26640718-26640740 GAGGATGGATGGTAGGAGGAGGG - Intergenic
1188614957 X:32146421-32146443 ATGGATGGATGGAAGGAGACAGG + Intronic
1188776014 X:34219655-34219677 CTGGATGGATAGGTGTAGGCAGG + Intergenic
1190212655 X:48460377-48460399 ATGGATGGCTAGAAAGAAGAGGG - Intronic
1190693911 X:52935379-52935401 CTGGCTGGATGGGAGGAGAATGG - Intronic
1190702822 X:53000820-53000842 CTGGGTGGAAACCAGGAGGACGG + Intergenic
1190980699 X:55454730-55454752 CTGGATGTCAAGAAGGAAGAAGG - Intergenic
1190987998 X:55518450-55518472 CTGGATGTCAAGAAGGAAGAAGG + Intergenic
1192474060 X:71424272-71424294 TTAGATGGATAGAAGATGGACGG - Intronic
1192617793 X:72646041-72646063 CTGCATGTATAGAGGGAGGTGGG + Intronic
1194359317 X:92929340-92929362 CTGGCTGTAAAGAAGGTGGAAGG - Intergenic
1195205462 X:102595426-102595448 CTGGATGGGTAGAAGGGAGAGGG - Intergenic
1195229276 X:102829808-102829830 CTGGAAGGAGAGCAGGAAGATGG + Intergenic
1195416442 X:104625173-104625195 ATGCATGGATGGATGGAGGATGG - Intronic
1196650126 X:118159915-118159937 ATGGATGGATGGATGGAGAATGG + Intergenic
1196653881 X:118196970-118196992 CTGGAAGGAAGGAAAGAGGATGG + Intergenic
1196811952 X:119635949-119635971 CAGGATGGAGTGAAGGAGGAGGG + Intronic
1197777310 X:130126958-130126980 TTGGATAGATAAAGGGAGGAGGG + Intergenic
1197949883 X:131882858-131882880 CTGGAAGTAGAGAAGGAGGGCGG + Intergenic
1198453758 X:136794672-136794694 GAGGATGGAGAGCAGGAGGAGGG - Intergenic
1199000260 X:142628162-142628184 TAGGGTGGATAGCAGGAGGAGGG - Intergenic
1199474348 X:148229296-148229318 CAGGATGAATGGAAGGGGGAGGG - Intergenic
1199665716 X:150094964-150094986 CTGGATGGCTTGGAAGAGGAAGG - Intergenic
1199717757 X:150518460-150518482 CAGGAGGAATAGAAGGAGGCTGG + Intergenic
1199782943 X:151080181-151080203 GGGGATGGATAGAATGAGGGAGG - Intergenic
1200667512 Y:6045175-6045197 CTGGCTGTAAAGAAGGTGGAAGG - Intergenic
1200978209 Y:9236335-9236357 ATGGAGGGAGAGAAGGAAGAGGG - Intergenic
1201238382 Y:11933705-11933727 ATAGATGGATAGATAGAGGATGG + Intergenic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic
1201625669 Y:16012068-16012090 ATGGAAGGAAAGAAGGAAGAAGG + Intergenic