ID: 1062103750

View in Genome Browser
Species Human (GRCh38)
Location 9:134741591-134741613
Sequence GTACAGAAGCAGAGGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062103742_1062103750 13 Left 1062103742 9:134741555-134741577 CCCTCTCAGGTGATAAGGGGCGC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1062103750 9:134741591-134741613 GTACAGAAGCAGAGGCAGGAGGG No data
1062103740_1062103750 16 Left 1062103740 9:134741552-134741574 CCTCCCTCTCAGGTGATAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1062103750 9:134741591-134741613 GTACAGAAGCAGAGGCAGGAGGG No data
1062103743_1062103750 12 Left 1062103743 9:134741556-134741578 CCTCTCAGGTGATAAGGGGCGCT 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1062103750 9:134741591-134741613 GTACAGAAGCAGAGGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062103750 Original CRISPR GTACAGAAGCAGAGGCAGGA GGG Intronic
No off target data available for this crispr