ID: 1062103750 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:134741591-134741613 |
Sequence | GTACAGAAGCAGAGGCAGGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1062103742_1062103750 | 13 | Left | 1062103742 | 9:134741555-134741577 | CCCTCTCAGGTGATAAGGGGCGC | 0: 1 1: 0 2: 0 3: 3 4: 57 |
||
Right | 1062103750 | 9:134741591-134741613 | GTACAGAAGCAGAGGCAGGAGGG | No data | ||||
1062103740_1062103750 | 16 | Left | 1062103740 | 9:134741552-134741574 | CCTCCCTCTCAGGTGATAAGGGG | 0: 1 1: 0 2: 0 3: 3 4: 76 |
||
Right | 1062103750 | 9:134741591-134741613 | GTACAGAAGCAGAGGCAGGAGGG | No data | ||||
1062103743_1062103750 | 12 | Left | 1062103743 | 9:134741556-134741578 | CCTCTCAGGTGATAAGGGGCGCT | 0: 1 1: 0 2: 0 3: 3 4: 45 |
||
Right | 1062103750 | 9:134741591-134741613 | GTACAGAAGCAGAGGCAGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1062103750 | Original CRISPR | GTACAGAAGCAGAGGCAGGA GGG | Intronic | ||
No off target data available for this crispr |