ID: 1062104028

View in Genome Browser
Species Human (GRCh38)
Location 9:134742932-134742954
Sequence CCAGTGAGTCCCGCCTTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062104024_1062104028 -2 Left 1062104024 9:134742911-134742933 CCATCAGTAAAGATTCAGGCCCC 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1062104028 9:134742932-134742954 CCAGTGAGTCCCGCCTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062104028 Original CRISPR CCAGTGAGTCCCGCCTTCCA TGG Intronic
No off target data available for this crispr