ID: 1062104881

View in Genome Browser
Species Human (GRCh38)
Location 9:134749913-134749935
Sequence CTGGCCACACAGACATACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 192}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062104881_1062104888 -3 Left 1062104881 9:134749913-134749935 CCTAGGTATGTCTGTGTGGCCAG 0: 1
1: 0
2: 2
3: 21
4: 192
Right 1062104888 9:134749933-134749955 CAGGTTGGCTGGGCGTGAGGAGG No data
1062104881_1062104891 24 Left 1062104881 9:134749913-134749935 CCTAGGTATGTCTGTGTGGCCAG 0: 1
1: 0
2: 2
3: 21
4: 192
Right 1062104891 9:134749960-134749982 TGTGTCGTTTACATATAAGTGGG No data
1062104881_1062104886 -6 Left 1062104881 9:134749913-134749935 CCTAGGTATGTCTGTGTGGCCAG 0: 1
1: 0
2: 2
3: 21
4: 192
Right 1062104886 9:134749930-134749952 GGCCAGGTTGGCTGGGCGTGAGG No data
1062104881_1062104890 23 Left 1062104881 9:134749913-134749935 CCTAGGTATGTCTGTGTGGCCAG 0: 1
1: 0
2: 2
3: 21
4: 192
Right 1062104890 9:134749959-134749981 CTGTGTCGTTTACATATAAGTGG No data
1062104881_1062104889 -2 Left 1062104881 9:134749913-134749935 CCTAGGTATGTCTGTGTGGCCAG 0: 1
1: 0
2: 2
3: 21
4: 192
Right 1062104889 9:134749934-134749956 AGGTTGGCTGGGCGTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062104881 Original CRISPR CTGGCCACACAGACATACCT AGG (reversed) Intronic
900952180 1:5864320-5864342 CCTGCCACACATACAGACCTTGG + Exonic
906436163 1:45798421-45798443 CTGGCCACACTGACTTGCTTTGG + Intronic
908174132 1:61537734-61537756 CAGGCCACACACACATTCATTGG - Intergenic
908253147 1:62281070-62281092 ATGGCCACACTCACATATCTGGG - Intronic
908276401 1:62476888-62476910 CTGGCCAAACTGACATAAATTGG - Intronic
908825220 1:68126439-68126461 CTGAGCACACAGAGACACCTAGG + Intronic
911250119 1:95566548-95566570 CTTCCCACAGAGACATACCTGGG - Intergenic
912380961 1:109248102-109248124 GTGGTCACACAGACACTCCTTGG + Intergenic
912480549 1:109979290-109979312 CTGGTCACACAGCCAGACCCCGG + Intergenic
922610642 1:226924491-226924513 CTGGCCACACATACCCCCCTGGG + Intronic
922666339 1:227472730-227472752 CAGGCCACACAAAAATTCCTGGG - Intergenic
922887313 1:229030059-229030081 CTGACCACACAGAGGTGCCTGGG - Intergenic
924389362 1:243535579-243535601 ATGTGCACACAGACACACCTTGG - Intronic
1062834953 10:629384-629406 CTGGACACACAGACACTCCCAGG + Intronic
1063900184 10:10724702-10724724 CTGACCACACCCACATACTTAGG - Intergenic
1065105186 10:22376731-22376753 CTGGCCACACAGACCAGCCCTGG - Intronic
1065361344 10:24891930-24891952 GTGACAACACAGACAAACCTGGG - Intronic
1066226474 10:33388131-33388153 CTGGTCACCCAGCCATGCCTAGG - Intergenic
1067204445 10:44201074-44201096 CTGGACACAGAGACACACATAGG + Intergenic
1067532727 10:47086188-47086210 CTGGCCTCACTGAGCTACCTTGG + Intergenic
1070670956 10:78376897-78376919 GTGTCCACACAGACTTTCCTGGG - Intergenic
1071609336 10:87019640-87019662 CTGGCCTCACAGACACTCTTGGG + Intergenic
1075622776 10:123939929-123939951 CTGTCCACACAGGCAGAGCTGGG + Intronic
1076429679 10:130393028-130393050 CTGGCTACACAGATGTACTTGGG - Intergenic
1076492883 10:130875517-130875539 AGGGCCACACACACAAACCTGGG + Intergenic
1077266570 11:1653699-1653721 CTGGACACACAGGCACACATGGG - Intergenic
1077298045 11:1835146-1835168 CTGGCACCACAGCTATACCTGGG + Exonic
1077456457 11:2684331-2684353 CAGGCCTCAAACACATACCTGGG - Intronic
1077467143 11:2738757-2738779 CTGGCCACACAGACAGACCCTGG + Intronic
1084087745 11:66862321-66862343 CTGGCCACACACACAGGCATAGG + Intronic
1084537032 11:69763364-69763386 CTGGACACACAGACACACAGAGG + Intergenic
1085662949 11:78386336-78386358 CTGGCTACAAGGACAGACCTAGG + Intronic
1086676088 11:89608664-89608686 CTGGACACACAGACATCCCAGGG - Intergenic
1089114414 11:116082734-116082756 CTGGCCCCACAGATCTTCCTGGG + Intergenic
1089175228 11:116544055-116544077 ATGCCCTCACAGACATACCCAGG - Intergenic
1089985088 11:122805052-122805074 CTGCTGACAAAGACATACCTGGG + Intronic
1090306241 11:125693553-125693575 CCTGCCAAACAGACATACCTGGG + Intergenic
1091191068 11:133695644-133695666 CAGCCCACACAGACACACCCAGG - Intergenic
1202806506 11_KI270721v1_random:8486-8508 CTGGCCAGCCAGACCTGCCTTGG - Intergenic
1091413281 12:258177-258199 CTGGCCAGAAAGAAATTCCTAGG + Intronic
1093498796 12:19786301-19786323 ATAGCCACAAAAACATACCTAGG - Intergenic
1095732475 12:45521119-45521141 ATCGCCTCACAGACATGCCTGGG + Intergenic
1096060326 12:48693087-48693109 CTGGCAATACAGACAAACCCCGG - Exonic
1096145597 12:49276677-49276699 CTGTCCACACAGCCGGACCTGGG - Intergenic
1097000276 12:55870743-55870765 ATGCCCACACAGACATACCCAGG - Intergenic
1100657811 12:96666415-96666437 CTGCTCATAAAGACATACCTGGG + Intronic
1100930370 12:99601941-99601963 CTGGCCACAAAGAAATACTCTGG - Intronic
1101063742 12:100998058-100998080 TTGGCCTCACAGACACACCCAGG - Intronic
1101762450 12:107670033-107670055 CTTGACACACAGACACAGCTTGG + Intergenic
1102672780 12:114634082-114634104 GTGGCCACACTGAGAAACCTTGG + Intergenic
1104052743 12:125207093-125207115 CTGGCCAAACAGATATGCCCTGG - Intronic
1106483426 13:30153894-30153916 CTTGCCACACGGACACTCCTCGG + Intergenic
1107107913 13:36666723-36666745 CTGGCCACACAGACATTGATGGG + Intergenic
1112240229 13:97674146-97674168 CTGGCCTCACACACGTCCCTGGG + Intergenic
1112608180 13:100928683-100928705 CTGTACAGACATACATACCTAGG - Intergenic
1112621077 13:101054399-101054421 ATGGCAAAACAGACATACCTTGG + Exonic
1112694943 13:101937414-101937436 CTGGACACACAGAGATCCCAGGG + Intronic
1113945818 13:114043573-114043595 CTTGCCACACAGACATACACAGG + Intronic
1117410130 14:55442869-55442891 CTGGACACACAGAGACACCAGGG + Intronic
1119298595 14:73552888-73552910 CTGCCCACACAGACAGGCCTGGG - Intronic
1119302889 14:73585064-73585086 CTGCCCACACAGACAGGCCTGGG - Intergenic
1119873951 14:78040818-78040840 CTGGTCACACAGACCAACCCTGG - Intergenic
1120008680 14:79388683-79388705 TGAGCCACACAGACATAGCTAGG - Intronic
1120989391 14:90361867-90361889 CAGCCTACACAGGCATACCTGGG + Intergenic
1121012929 14:90532717-90532739 CTGGCCAGACACAGGTACCTGGG - Exonic
1122423370 14:101591096-101591118 CTGGCAAAACAGACCTACCTGGG - Intergenic
1123675530 15:22707682-22707704 ATGGCAACACAGATATATCTTGG + Intergenic
1124327520 15:28780622-28780644 ATGGCAACACAGATATATCTTGG + Intergenic
1124529531 15:30492630-30492652 ATGGCAACACAGATATATCTTGG + Intergenic
1125311595 15:38385132-38385154 CTGGCCACCCAGAACTCCCTGGG + Intergenic
1125890172 15:43260034-43260056 CTGGGCACCCAGCCTTACCTGGG + Exonic
1126268106 15:46778819-46778841 CTGGCAAGAGAGACAAACCTTGG - Intergenic
1128723219 15:69968382-69968404 CTGGGCACACAGTCCTCCCTGGG - Intergenic
1131138208 15:89955498-89955520 CTGCCGATAAAGACATACCTGGG + Intergenic
1131968944 15:97873472-97873494 TTGGACACACAGAGATACCAGGG - Intergenic
1132592273 16:731236-731258 AGGGCCTCACAGACATCCCTGGG - Intronic
1132606761 16:796913-796935 CTGGCCACACAGGGATACAGTGG - Intronic
1133309319 16:4833297-4833319 ATGGCCACACACAGATCCCTGGG + Intronic
1135695038 16:24578167-24578189 CTTGGCACACAGAAACACCTAGG - Intergenic
1135856687 16:26018152-26018174 CTGGCCACACAGAGATAAAAAGG - Intronic
1137874937 16:51987130-51987152 CTGGACACACAGCCACACCCAGG + Intergenic
1138585302 16:57965896-57965918 GTGCACACACAGACATACCAAGG + Intronic
1139391626 16:66609291-66609313 CTGGCCCCACCCACATGCCTAGG - Intronic
1139405983 16:66718001-66718023 CTAGCCTCACAGGCACACCTAGG + Intergenic
1141303339 16:82838077-82838099 CTGGCCCCAAAGCCTTACCTTGG + Intronic
1142863966 17:2779332-2779354 CTGGCCACACAGAAATACCCCGG - Intronic
1143301105 17:5911235-5911257 CTGGGCACACAGACCTGCATGGG + Intronic
1144599203 17:16598145-16598167 CTGGCCAAACTGATCTACCTTGG + Intergenic
1144714215 17:17422893-17422915 CTGGCCAGACAGAGTTCCCTGGG - Intergenic
1144953222 17:19004868-19004890 CTCGACAGACAGACAGACCTGGG + Intronic
1146654893 17:34629336-34629358 CTTCTCACACAGGCATACCTGGG - Intronic
1147240220 17:39085928-39085950 CTGGCCACAGAGAAACTCCTGGG + Intronic
1147476291 17:40714742-40714764 CTGGCTGCACAGACTTCCCTTGG + Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1149014561 17:51892687-51892709 CTGGCCAATCAGACATAGGTGGG + Intronic
1150346786 17:64410899-64410921 CTGGCCACACAGACAAGACATGG - Intronic
1151383453 17:73741127-73741149 CTGGCCAGTCGGACAAACCTAGG + Intergenic
1155840023 18:30632405-30632427 CTGGCCTCAGAGACAGCCCTGGG + Intergenic
1159913412 18:74167218-74167240 CTGGGCACACAGAGACACCAGGG + Intergenic
1159957983 18:74533301-74533323 CTGGACACACACACATACACAGG + Intergenic
1161704918 19:5815149-5815171 CTGGCCACACACACACACAGGGG - Intergenic
1161993604 19:7699041-7699063 CTGACCACAGAGACAGATCTGGG + Intronic
1164794818 19:31017349-31017371 CTGCTAATACAGACATACCTGGG + Intergenic
1164944927 19:32285587-32285609 CTGGCCACTCAGACATCTTTGGG - Intergenic
1165464268 19:35963366-35963388 CTGTGGACACAGACAGACCTGGG - Intergenic
1166640805 19:44493631-44493653 TTGGTCACACAGACCCACCTTGG - Intronic
1168104273 19:54156985-54157007 CTGGGCATCCTGACATACCTGGG - Exonic
926003256 2:9351508-9351530 CCTGCCACACAGAACTACCTAGG - Intronic
926885617 2:17595740-17595762 TTGGACACAGAGACATACATAGG + Intronic
927187261 2:20490744-20490766 CCACCCACACACACATACCTCGG - Intergenic
928111809 2:28516706-28516728 CTGGGCACACAGATATGGCTAGG + Intronic
930211117 2:48638216-48638238 CTGGCCTCACAGAATTAGCTGGG - Intronic
931243156 2:60470490-60470512 CTGGGATCACAGAGATACCTGGG - Intronic
931457285 2:62421483-62421505 ATAGCCACACAAAAATACCTAGG + Intergenic
931607544 2:64067121-64067143 CCTGCCAGACAGACATACCAAGG + Intergenic
931893885 2:66707108-66707130 CTGGTCACACAGACCAGCCTTGG - Intergenic
935550202 2:104444850-104444872 AAGGCCACAGAGACACACCTTGG - Intergenic
936473074 2:112816028-112816050 CTGTCCCCACAGACCTCCCTTGG + Intergenic
937878300 2:126843473-126843495 TTGGCCACACAGGCAAACCCTGG + Intergenic
941354196 2:164468549-164468571 CTGCACACACAGACATACACAGG + Intergenic
946116043 2:217463326-217463348 ATGGCCACATAAACATACCTGGG - Intronic
946381625 2:219352809-219352831 CTTTCCACACAGACAGACCCAGG - Intergenic
948716801 2:239870426-239870448 CTGGACACGCAGCCTTACCTCGG + Intergenic
1169920895 20:10733263-10733285 CTGGGCACACTCACATGCCTGGG + Intergenic
1173759650 20:45548273-45548295 CTGGCCACTCAGCCAGTCCTGGG + Intergenic
1173808316 20:45940608-45940630 CTGGCCACAGACACTCACCTTGG - Exonic
1174384582 20:50179555-50179577 CTGTCCACACACACATACAGTGG - Intergenic
1175271497 20:57737167-57737189 CTGGCCACACTGACCCACGTGGG + Intergenic
1175945524 20:62556750-62556772 ATGGCCACACAAACCCACCTGGG - Intronic
1178142417 21:29699381-29699403 CTGGACACACAGATATACCAGGG + Intronic
1179089969 21:38255888-38255910 CTGGCCCCACCGACATGCCTGGG + Intronic
1179784607 21:43722288-43722310 CTTTCCACACATACACACCTGGG - Intronic
1180085528 21:45506450-45506472 CTGGCTCCTCAGACACACCTGGG + Intronic
1181133771 22:20750239-20750261 CTGGACACACAGAAATACTGGGG + Intronic
1181277832 22:21697588-21697610 CTGGCCACACCGCCAGCCCTTGG - Exonic
1184455937 22:44609439-44609461 CTGGGGACACAGAGATGCCTGGG + Intergenic
950540583 3:13609922-13609944 CTGGCCAGAAAGAAATCCCTGGG - Intronic
952865702 3:37853907-37853929 CTGGTCACAGACACACACCTTGG - Intergenic
952946606 3:38482139-38482161 CTGGCCATACACACACAGCTGGG - Intronic
953355395 3:42251993-42252015 GTGGCCACACACACAAACCTCGG + Intergenic
958680690 3:97327535-97327557 CTTGACACACAAACATACATAGG - Intronic
959405625 3:105958973-105958995 CTAGCAACACAGAAATACCTGGG + Intergenic
960294369 3:115925117-115925139 CTAGGAACACACACATACCTGGG - Intronic
961397373 3:126604984-126605006 CTGGCCACACAGACCAGCCCTGG + Intronic
966830379 3:184002879-184002901 CTGGCAACAGAGAGGTACCTCGG + Intronic
966884881 3:184371820-184371842 CTGTCTACACAGCCTTACCTGGG + Intronic
968705669 4:2076277-2076299 CTGGCCACACAGACCGCACTGGG + Intronic
968818523 4:2833885-2833907 CAGGCCACACAGACGGACATGGG + Exonic
968893956 4:3388074-3388096 CTGGCCACGCAGAGATCCCCTGG + Intronic
968965744 4:3768259-3768281 CTGACCTCACAGCCACACCTCGG - Exonic
968966501 4:3771573-3771595 CTGGCCACACAGTCACCTCTAGG - Intergenic
970354958 4:15242783-15242805 CTGGCCACAGTGACAGACTTAGG + Intergenic
975456796 4:74600462-74600484 CTGCACACACTGACATATCTTGG + Intergenic
976029582 4:80735941-80735963 CTGGCCTCTCAGAATTACCTTGG + Intronic
979357415 4:119721406-119721428 CTAGCTACACACACATACCATGG + Intergenic
980602515 4:135042427-135042449 ATGCCCTCACAGACATACCCAGG - Intergenic
980874360 4:138645996-138646018 CTGGCCCCACAGACAGACTTTGG + Intergenic
981125238 4:141098348-141098370 CAGGCCAGTCAGACATCCCTGGG + Intronic
981329586 4:143493102-143493124 ATAGCCACACATAAATACCTAGG + Intergenic
981956827 4:150485559-150485581 CTGGACACAGAGACATACACAGG + Intronic
982702635 4:158672750-158672772 CTGTCAACACACACACACCTCGG + Intronic
987626723 5:20411789-20411811 CTGCCCACAAAAAAATACCTAGG + Intronic
989164251 5:38419115-38419137 TTGGACATACAGACATACCAGGG - Intronic
993203696 5:84849953-84849975 CAGACCTCACAGACACACCTAGG - Intergenic
997200108 5:132004801-132004823 CTGCCACCACAGACAGACCTAGG + Intronic
997248872 5:132373751-132373773 CTGGCCCCTCAGTCATCCCTGGG + Intronic
998079607 5:139263578-139263600 TTGGTCACACAGACAAACCCTGG - Intronic
998575610 5:143312258-143312280 TTGGCCACACAGACCAATCTTGG - Intronic
1000251317 5:159498207-159498229 ATGGTCACACAGTCAGACCTGGG + Intergenic
1001308203 5:170590997-170591019 CTGACCACACAGACTTCCCTTGG + Intronic
1001423046 5:171601326-171601348 CTGGGCACAGAGCCAGACCTGGG - Intergenic
1002413074 5:179099385-179099407 CTGGCCACAAAGAAAAGCCTGGG + Intergenic
1005935160 6:30515595-30515617 CTGGCCTCACAGACTTGCCCAGG + Intergenic
1006106508 6:31720092-31720114 CTGACAACACATGCATACCTTGG - Exonic
1006425315 6:33959683-33959705 CTGGCCACCTGGACATTCCTCGG + Intergenic
1008336025 6:50305890-50305912 TTGGCCATACAGACAAACCCTGG - Intergenic
1009697978 6:67134346-67134368 CTAGCAACACAGATATACTTCGG + Intergenic
1010290075 6:74125469-74125491 CTGGCCGTACAGTCATCCCTTGG + Intergenic
1012998108 6:105993411-105993433 CTGATTACACAAACATACCTAGG - Intergenic
1013704058 6:112811551-112811573 CTTACCACTCAGACATTCCTTGG - Intergenic
1014432871 6:121390276-121390298 CTGGCCACACTGACAGGCCCTGG + Intergenic
1014852929 6:126363265-126363287 TAGGCCAAACATACATACCTGGG - Intergenic
1016931723 6:149417757-149417779 CTGTCCTGACAGTCATACCTTGG - Intergenic
1017727677 6:157286961-157286983 CAGGGCACACAGAAATATCTTGG - Intergenic
1018879110 6:167858042-167858064 CTACCCACACAGACATACACTGG - Intronic
1019385447 7:753200-753222 CAGGCCACACAGACTTGCCCTGG + Intronic
1019394822 7:812196-812218 CTGGCCACAGAGCCATTGCTGGG - Intergenic
1020576660 7:9940469-9940491 ATACCCACACAGACATACCCAGG - Intergenic
1024276788 7:47683976-47683998 CTGGCCAAACACGCCTACCTTGG + Intergenic
1026278575 7:68902018-68902040 CTGCTGATACAGACATACCTGGG - Intergenic
1030346710 7:108442104-108442126 CTGCCCATACAGTAATACCTTGG + Intronic
1031223879 7:119009202-119009224 TTTGCCACACAGACATGCATAGG - Intergenic
1032067404 7:128782106-128782128 CTGGGCACACAGAAATGCCTGGG + Intergenic
1032319071 7:130868300-130868322 CTGGCCGCACCCACATACCAGGG + Intergenic
1034333312 7:150302755-150302777 CTTGCCCCACAGCCATAACTCGG - Intronic
1034664731 7:152807138-152807160 CTTGCCCCACAGCCATAACTCGG + Intronic
1034742486 7:153490234-153490256 CTGGCCTCATAGAAATAGCTAGG - Intergenic
1037070952 8:14648252-14648274 CTAGCCAGACAGAGATACCTTGG - Intronic
1048160487 8:132016447-132016469 CTGGCCCCACATAGACACCTGGG + Intergenic
1048689957 8:136950990-136951012 TTTGCCACACAAACATAACTTGG - Intergenic
1049791738 8:144475466-144475488 CTGGTCCCACTGGCATACCTGGG + Intronic
1050476410 9:6045605-6045627 CTGGTCACACGGACAGACTTAGG + Intergenic
1052463761 9:28802742-28802764 TTTGCCACACAGATATGCCTTGG - Intergenic
1054763618 9:69024874-69024896 CTGGTCACACAGACCAACCCTGG + Intergenic
1055126646 9:72726013-72726035 GTACCCACACAGACATGCCTAGG + Intronic
1057082302 9:92181900-92181922 CTGGCGGCACAGGCATTCCTTGG + Intergenic
1058348554 9:103993996-103994018 TAGTCCATACAGACATACCTTGG + Intergenic
1058592890 9:106584252-106584274 CTTGCCACAGAGACAGAGCTGGG - Intergenic
1059483006 9:114606712-114606734 CTGGGAACTCAGACAGACCTGGG - Intergenic
1059782062 9:117540260-117540282 CTGGCCACTTAGACATTTCTGGG + Intergenic
1060029617 9:120203127-120203149 CAGGCCTCACATAAATACCTGGG + Intergenic
1061805189 9:133133782-133133804 CTGGCCACACACACAAGCCCAGG + Intronic
1062104881 9:134749913-134749935 CTGGCCACACAGACATACCTAGG - Intronic
1186979072 X:14939702-14939724 TTGGCTACACAGAATTACCTGGG - Intergenic
1189740480 X:44112626-44112648 CTGGCAACACACACATGCCTTGG + Intergenic
1192527117 X:71856664-71856686 ATTGCCACACAGACATACCCAGG - Intergenic