ID: 1062105762

View in Genome Browser
Species Human (GRCh38)
Location 9:134753940-134753962
Sequence CGCTGCCGCCGGAGAACGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062105762_1062105767 -10 Left 1062105762 9:134753940-134753962 CCTCCCGTTCTCCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1062105767 9:134753953-134753975 GGCGGCAGCGACGGCGAGCATGG 0: 1
1: 0
2: 2
3: 34
4: 269
1062105762_1062105774 30 Left 1062105762 9:134753940-134753962 CCTCCCGTTCTCCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1062105774 9:134753993-134754015 CATGTTTTCAAGGAAATTCGTGG 0: 1
1: 0
2: 1
3: 11
4: 150
1062105762_1062105768 -7 Left 1062105762 9:134753940-134753962 CCTCCCGTTCTCCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1062105768 9:134753956-134753978 GGCAGCGACGGCGAGCATGGAGG 0: 1
1: 0
2: 0
3: 13
4: 110
1062105762_1062105773 20 Left 1062105762 9:134753940-134753962 CCTCCCGTTCTCCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1062105773 9:134753983-134754005 CCAACTGCTGCATGTTTTCAAGG 0: 1
1: 0
2: 0
3: 16
4: 197
1062105762_1062105769 -6 Left 1062105762 9:134753940-134753962 CCTCCCGTTCTCCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1062105769 9:134753957-134753979 GCAGCGACGGCGAGCATGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062105762 Original CRISPR CGCTGCCGCCGGAGAACGGG AGG (reversed) Intronic
900240771 1:1616226-1616248 CGCCGGCGCAGGGGAACGGGCGG - Intronic
901086690 1:6615072-6615094 GGCTGCCGCGGGAGGGCGGGTGG + Intronic
903781156 1:25820674-25820696 CGGTGCTGCCGGCGAACCGGGGG + Intronic
904181401 1:28668997-28669019 CGCCGCCGCCGGGGAGCGAGCGG + Intronic
920367762 1:205457050-205457072 CGCCGCCGCCGGAGGCCGCGCGG + Intergenic
1069546738 10:69334524-69334546 CGCTGCCGGGGGAGAAGGGCTGG + Intronic
1077136229 11:1000497-1000519 CGCTGCCGCCGGAGGAGGGTGGG - Exonic
1080496954 11:32829918-32829940 GGCGGCCGACGGAGGACGGGAGG - Intergenic
1096077642 12:48815146-48815168 AGCCGCCGCCGGAGGATGGGCGG + Intronic
1096157297 12:49347753-49347775 CGCTGCCGCCGATGGAAGGGGGG - Exonic
1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG + Intronic
1103400725 12:120641167-120641189 CGCTGCCGCCGGCCCGCGGGCGG + Exonic
1110219583 13:73059219-73059241 GGCTGCCGGCGGAGGAGGGGAGG - Exonic
1113480418 13:110616021-110616043 CGCGGTGGCCGGGGAACGGGGGG + Intronic
1123480683 15:20628734-20628756 CGCCGCCCGAGGAGAACGGGAGG - Intergenic
1123637326 15:22371633-22371655 CGCCGCCCGAGGAGAACGGGAGG + Intergenic
1124244467 15:28057768-28057790 CGCTGCTGCAGGGGAACAGGTGG + Intronic
1133097582 16:3458002-3458024 CGCTGCCGGCAGGGAGCGGGAGG + Intronic
1139459429 16:67110036-67110058 CGCTGCCGCCGGGGAGGAGGTGG + Exonic
1141582722 16:85011321-85011343 CGCCGCCGCCGCAGGCCGGGAGG - Exonic
1142280775 16:89146511-89146533 AGGTGCCGACGGAGAATGGGTGG - Intronic
1142859952 17:2755522-2755544 CGCCGGCCCCGCAGAACGGGCGG - Intergenic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG + Exonic
1147971297 17:44220070-44220092 TGCCGCCGCCGGGGAAGGGGGGG + Intronic
1151589705 17:75035100-75035122 AGCTGCAGCCGGAGACCGCGTGG + Intronic
1155461725 18:26090908-26090930 CGCCGCCGCGGGAGAAGGAGAGG + Intronic
1158976479 18:62715641-62715663 CGCTGCCTCCGGAGCTGGGGGGG + Exonic
1160535897 18:79591187-79591209 AGCTGCTGCTGGAGAACGGAGGG - Intergenic
1160734891 19:657994-658016 TGCTGCCCCCGGAGAAGGTGGGG - Intronic
1160873166 19:1286076-1286098 CGCCGCCGCCGCCGAGCGGGCGG - Intergenic
1160967627 19:1753570-1753592 CGCAGCCACCGGGGAGCGGGCGG + Exonic
1163157929 19:15449397-15449419 CACTGCCCGCGGGGAACGGGCGG + Intronic
1167313960 19:48753149-48753171 GGCTGCCGCCGGAGCGCGCGAGG + Intronic
1168271868 19:55254532-55254554 CTCTGCCGCCAGGGAACCGGTGG + Intronic
925959863 2:9004080-9004102 GGCCGTCGCCGGAGAACGGCTGG + Intergenic
927900336 2:26814222-26814244 GGCTGACGCAGGAGAACGGCTGG + Intergenic
933666908 2:84971402-84971424 CACTGCAGCCGGAGCCCGGGAGG + Exonic
934857389 2:97737813-97737835 CGCTGCGGCTGGAGAACTTGCGG - Exonic
938339806 2:130527833-130527855 CGCTCCCGCTGGAGGACGGAAGG - Exonic
938350030 2:130592917-130592939 CGCTCCCGCTGGAGGACGGAAGG + Exonic
942241107 2:173964673-173964695 CGCCGCCGCCGGGGGGCGGGTGG - Intronic
1169664522 20:8019500-8019522 CGCTGCCGCCGGAGCAGAGCCGG - Exonic
950452566 3:13073420-13073442 CGCAGCATCCGGAGAAGGGGCGG + Intergenic
954779069 3:53046016-53046038 CGCCTCCGCCGGAGCGCGGGTGG - Exonic
959530736 3:107431544-107431566 CGCCGCCGCCGGGGCTCGGGCGG + Intergenic
965232204 3:166068998-166069020 GGCTGACGCAGGAGAACGGCGGG + Intergenic
968756084 4:2417353-2417375 CGCTGCAGCCGGAGCAGGGCCGG - Intronic
969357817 4:6640984-6641006 CGCTGACGCGCGAGCACGGGCGG + Exonic
969569582 4:8000753-8000775 GGCTGCTGCCTGGGAACGGGAGG + Intronic
972396518 4:38663730-38663752 CGCCGCCGCCCGAGCCCGGGGGG - Intergenic
978361127 4:107931875-107931897 CTCCGCCGCCGGAGGAAGGGAGG - Exonic
998228786 5:140346247-140346269 CGACGCCCCCGGAGATCGGGGGG - Intronic
1000220460 5:159209309-159209331 CGCCGCCCGAGGAGAACGGGAGG - Intronic
1007636263 6:43301594-43301616 AGTGGCCGCCGGGGAACGGGTGG + Exonic
1009437627 6:63636077-63636099 CGCTGCCGCCGCCGAAGAGGAGG - Exonic
1017146395 6:151239725-151239747 CCCTTCCCCCGGGGAACGGGGGG - Intergenic
1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG + Intronic
1018890106 6:167976993-167977015 CGATGCCGGCGGGGAGCGGGCGG + Intergenic
1027244783 7:76359394-76359416 CGCAGGCGCAGGAGGACGGGGGG + Intergenic
1031966910 7:128033051-128033073 CGCTGCCCCCAGAGAACTGGGGG + Intronic
1031972502 7:128074751-128074773 TGCTGCCTCCAGAGAACAGGAGG + Intronic
1039545114 8:38404378-38404400 TCCTGCCACTGGAGAACGGGAGG - Exonic
1041201117 8:55452564-55452586 CGGTGCAGCGGGAGAACCGGAGG - Intronic
1049537437 8:143188894-143188916 CACTGCTGCGGGAGAATGGGTGG + Intergenic
1062043302 9:134414009-134414031 CGCTGGCGCCGGAGGCCGGGCGG - Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062288428 9:135784065-135784087 CGCGGCCGGCGGCGAACGGCAGG - Exonic
1189002061 X:36957880-36957902 CGCTGCCGCCCGAGGACGCCAGG - Intergenic