ID: 1062105762

View in Genome Browser
Species Human (GRCh38)
Location 9:134753940-134753962
Sequence CGCTGCCGCCGGAGAACGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062105762_1062105773 20 Left 1062105762 9:134753940-134753962 CCTCCCGTTCTCCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1062105773 9:134753983-134754005 CCAACTGCTGCATGTTTTCAAGG 0: 1
1: 0
2: 0
3: 16
4: 197
1062105762_1062105774 30 Left 1062105762 9:134753940-134753962 CCTCCCGTTCTCCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1062105774 9:134753993-134754015 CATGTTTTCAAGGAAATTCGTGG 0: 1
1: 0
2: 1
3: 11
4: 150
1062105762_1062105768 -7 Left 1062105762 9:134753940-134753962 CCTCCCGTTCTCCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1062105768 9:134753956-134753978 GGCAGCGACGGCGAGCATGGAGG 0: 1
1: 0
2: 0
3: 13
4: 110
1062105762_1062105767 -10 Left 1062105762 9:134753940-134753962 CCTCCCGTTCTCCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1062105767 9:134753953-134753975 GGCGGCAGCGACGGCGAGCATGG 0: 1
1: 0
2: 2
3: 34
4: 269
1062105762_1062105769 -6 Left 1062105762 9:134753940-134753962 CCTCCCGTTCTCCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1062105769 9:134753957-134753979 GCAGCGACGGCGAGCATGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062105762 Original CRISPR CGCTGCCGCCGGAGAACGGG AGG (reversed) Intronic