ID: 1062105767

View in Genome Browser
Species Human (GRCh38)
Location 9:134753953-134753975
Sequence GGCGGCAGCGACGGCGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 269}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062105757_1062105767 15 Left 1062105757 9:134753915-134753937 CCTTGCCTTCGCTGTCTGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1062105767 9:134753953-134753975 GGCGGCAGCGACGGCGAGCATGG 0: 1
1: 0
2: 2
3: 34
4: 269
1062105762_1062105767 -10 Left 1062105762 9:134753940-134753962 CCTCCCGTTCTCCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1062105767 9:134753953-134753975 GGCGGCAGCGACGGCGAGCATGG 0: 1
1: 0
2: 2
3: 34
4: 269
1062105759_1062105767 10 Left 1062105759 9:134753920-134753942 CCTTCGCTGTCTGGTGGGCGCCT 0: 1
1: 0
2: 1
3: 3
4: 77
Right 1062105767 9:134753953-134753975 GGCGGCAGCGACGGCGAGCATGG 0: 1
1: 0
2: 2
3: 34
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062105767 Original CRISPR GGCGGCAGCGACGGCGAGCA TGG Intronic
901250071 1:7771346-7771368 GGCGGCAGCGGCGACGAGAGAGG - Exonic
902585849 1:17438348-17438370 GGCAGCAGCGGCGACGAGGACGG - Exonic
903279775 1:22243938-22243960 GGAGCCAGCGAGGGCGGGCAGGG - Intergenic
903324745 1:22563458-22563480 GGCGGCGGCGGCGGCGGGCGCGG + Intergenic
903499275 1:23792708-23792730 GGTGGCAGCATCGGTGAGCAGGG - Exonic
903777136 1:25800337-25800359 GGCAGCGGCGGCGGCCAGCAGGG - Exonic
903907457 1:26696665-26696687 GCCGGCAGCGGCGGCGGGCCCGG + Exonic
903925154 1:26826708-26826730 GGTGGCAGCGGCGGCGCGCGCGG - Exonic
904613481 1:31737660-31737682 GGCGGCATAGATGGCGAGCAGGG + Exonic
904891535 1:33783205-33783227 GGGGGCAGAGATGGCGAGCTTGG + Intronic
905731979 1:40304005-40304027 GGCGGCGGGGACGCAGAGCAGGG + Intronic
912927904 1:113929715-113929737 GGCGGCGGCGGCGGCGGGAAGGG + Exonic
918708870 1:187703469-187703491 GGAGGCACCGAGAGCGAGCAAGG - Intergenic
921023835 1:211259705-211259727 TGCAGCAGCGACGACGAGCACGG + Exonic
922416735 1:225428573-225428595 AGCGGCATCGAAGGCGAGCAGGG + Intronic
923171554 1:231421898-231421920 GGCGGCGGCGACGGCGACTGCGG + Exonic
923975339 1:239256014-239256036 GGAGGCACCGAGAGCGAGCAAGG + Intergenic
1064155312 10:12898682-12898704 GGAGGCAGAGACAGCGTGCAAGG + Intronic
1064408857 10:15088453-15088475 GGCAGGAGCGCCGGGGAGCACGG - Intronic
1064553117 10:16521724-16521746 AGCGGCGGCGGCGGCGGGCACGG + Exonic
1065240159 10:23695911-23695933 GGCGACAGCGCCCGGGAGCAGGG + Intronic
1069280911 10:66651947-66651969 GGAGGCACCGAGAGCGAGCAAGG + Intronic
1070327566 10:75398725-75398747 GGCGGCCGGGAGGGCGAGCGAGG - Exonic
1070333070 10:75431657-75431679 GGCGGCAGCAGCGGGGAGCGCGG - Intronic
1070844674 10:79512548-79512570 GGCGGCGGCGGCGGCGGGCTCGG + Intergenic
1070929130 10:80247763-80247785 GGCGGCGGCGGCGGCGGGCTCGG - Intergenic
1072731496 10:97849964-97849986 GGCGGCGGCGGCGGCGGGGATGG - Intergenic
1072731572 10:97850203-97850225 GGCGGCGGTGGCGGCGAGCTGGG - Intergenic
1075118983 10:119651057-119651079 GGCGGCAGGCACGGGGAGCACGG + Intergenic
1075627360 10:123972592-123972614 TGCGGCAGCGATGGGGAGAAGGG + Intergenic
1076186879 10:128457257-128457279 GGCTTCAGGGACAGCGAGCAGGG + Intergenic
1077054109 11:581997-582019 GACGACAGTGACAGCGAGCATGG + Exonic
1077095713 11:798216-798238 CGCGGCGGCGGCGGCGAGCGTGG - Exonic
1077253840 11:1572037-1572059 GGCGGCGGCGACGGCGGCGACGG - Intergenic
1078190839 11:9091607-9091629 GGTGGCAGCGGCAGCGGGCAGGG - Intronic
1082003738 11:47408635-47408657 GGCGGCGGCGGCGGCGATCCGGG - Exonic
1083207492 11:61161394-61161416 GGCGGCGGCGACGGCGGCCCTGG - Exonic
1083246210 11:61429923-61429945 GGCGGCGGCGGCGGCGAGTCCGG + Intronic
1084151570 11:67290004-67290026 GGAGGCTGCCAGGGCGAGCAGGG - Intronic
1084771609 11:71346098-71346120 GGCAGCAGGGACAGTGAGCAAGG - Intergenic
1085597167 11:77820681-77820703 GGCGGCAGCGGCGGCGGTGATGG - Exonic
1089234378 11:117010589-117010611 GGTGGCAGGGACTGGGAGCATGG - Intronic
1089560299 11:119340219-119340241 GACGGCCGCGACGGCGCGCCCGG - Exonic
1090832356 11:130428266-130428288 GGCGGCGGGGGCGGGGAGCATGG + Exonic
1091224062 11:133947100-133947122 GGCAGCAGAGAGGGCGAGCAAGG + Intronic
1092518441 12:9240424-9240446 GGAGGCGGCTGCGGCGAGCAAGG + Intergenic
1092796038 12:12111032-12111054 GGAGGCGGCTGCGGCGAGCAAGG - Intronic
1092868680 12:12786850-12786872 GGCGGGAGCGGCGGCTGGCACGG + Intronic
1094041118 12:26122634-26122656 GGCGGCAGCGGCGGCGGCCCGGG - Exonic
1097176646 12:57147230-57147252 GGCGGCAGGGACGTGGAGCAGGG - Intronic
1097267801 12:57755769-57755791 GGCGGCAGCGGCGGCGCGGGCGG - Exonic
1102136860 12:110582928-110582950 GGCGGCGGCGGCGGCGACTACGG - Exonic
1102480734 12:113221554-113221576 GGCGGCGGCGCCGGCGGGCTAGG + Exonic
1103400643 12:120640907-120640929 GGCGGCGGCGGCGGCGAGCGGGG + Exonic
1103764670 12:123271669-123271691 GGCGGCGGCGGCGGCGAGGCCGG + Exonic
1105409626 13:20161021-20161043 GGCTGCAGGGATGGCGATCAGGG - Exonic
1106163303 13:27219614-27219636 GGAGGCACCGAGAGCGAGCAAGG - Intergenic
1110558509 13:76886250-76886272 GGCGGCGGCGGCGGGGCGCAGGG - Exonic
1110965482 13:81689937-81689959 GGAGGCGGCTGCGGCGAGCAAGG - Intergenic
1111006571 13:82257831-82257853 GGAGGCACCGAGAGCGAGCAAGG - Intergenic
1111951331 13:94711615-94711637 GGCGGCAGCGGCGGCGGCCGCGG + Exonic
1112216257 13:97434109-97434131 GGCGGCGGCGGCGGCGGGCGGGG + Intergenic
1113372035 13:109733163-109733185 GGAGGCACCGAGAGCGAGCAAGG + Intergenic
1114155463 14:20099038-20099060 GGAGGCACCGAGAGCGAGCAAGG - Intergenic
1116657972 14:47674992-47675014 GGCGGCGGCGGCGGCGCGCTGGG + Intergenic
1116821763 14:49634058-49634080 GGCGGCGGCGACGGCGACAGCGG + Exonic
1116916723 14:50532495-50532517 GGCGGCGGCGACGGCAAACCCGG - Exonic
1117315108 14:54565987-54566009 GGCGGCGGCGACGGCACGCGGGG - Intergenic
1119726523 14:76924855-76924877 GGCGGCAGCCACAGGGAGCTGGG - Intergenic
1122162373 14:99793590-99793612 GGCGGCGGCGACGGCGACGGCGG + Intronic
1122470801 14:101964704-101964726 GGGGGCGGCGGCGGCGAGGACGG + Exonic
1122672857 14:103385449-103385471 GGCGGCAGCGGCGGCCAGCAGGG + Intronic
1123024957 14:105420109-105420131 GGCGGCAGCGGCGGCGGGTGGGG - Intronic
1123630589 15:22257727-22257749 GGCGGCGGCGACGGCGACGACGG - Intergenic
1128841445 15:70854145-70854167 GTCGGCAGCGACTGCGACGAGGG + Exonic
1129322361 15:74782281-74782303 GGCGGGAGGGACGGCGGGCCGGG - Exonic
1129710786 15:77819387-77819409 GGTGGCCGCGGCGGCGAGCGCGG + Intronic
1129848264 15:78777901-78777923 GGCTGCAGGGTCGGAGAGCAGGG - Intronic
1130115304 15:81000960-81000982 GGCGGCGGCGGCGGCGAGCCCGG + Exonic
1130253662 15:82316035-82316057 GGCTGCAGGGTCGGAGAGCAGGG + Intergenic
1130397153 15:83512677-83512699 GGAGGCAGGGACGGGGAGGAAGG - Intronic
1132368656 15:101277414-101277436 GGCGGCGGCGGCGGCGGTCATGG - Exonic
1136542400 16:30935466-30935488 GGCAGCAGGGAAGGCGTGCAGGG + Intronic
1137426571 16:48385376-48385398 GGCGGCGGCGGCGGCGGCCAGGG - Intronic
1137617791 16:49857313-49857335 GGCGGCGGCGGCGGCAGGCACGG + Intronic
1139377789 16:66511242-66511264 GGCTGCAGCGACCTCGGGCAGGG + Exonic
1139410055 16:66751667-66751689 GGCGCGAGGGACGGCGAGCGGGG - Exonic
1139570127 16:67806512-67806534 GGCGGCAGCGACGGCAGACCCGG - Exonic
1139917797 16:70438976-70438998 GGCGGCCGGAGCGGCGAGCATGG - Intronic
1141079303 16:81036302-81036324 AGCGGCAGCGGCAGCGCGCAGGG - Intronic
1142137119 16:88456556-88456578 GGGGGCAGCCAAGGGGAGCAGGG + Intronic
1142656820 17:1399943-1399965 GGCGGCATCGTCTGCGAGCCTGG - Intronic
1142799712 17:2337554-2337576 GGCGGCGGCGGCGGCGGGCCGGG + Exonic
1143390454 17:6556518-6556540 GGCGGCAGCCGAGGCGAGCGGGG - Intergenic
1143517316 17:7426387-7426409 TGCAGCAGCGACGGCGACAACGG - Exonic
1143609943 17:8012383-8012405 GGGGGCAGGGATGGGGAGCAAGG + Intronic
1144128007 17:12220755-12220777 GGCGGCACCGAGAGCGAGCGAGG - Intergenic
1144608829 17:16690572-16690594 GTCGGCAGCGAGAGCAAGCACGG + Exonic
1144724539 17:17495252-17495274 GGCGGCGGCGGCGGCGACCCGGG - Exonic
1144786863 17:17836894-17836916 GGCGGCGGCGACTGAGAGCCGGG - Exonic
1144903995 17:18625254-18625276 GTCGGCAGCGAGAGCAAGCACGG - Intergenic
1145128590 17:20321488-20321510 GTCGGCAGCGAGAGCAAGCACGG + Intergenic
1145196030 17:20895827-20895849 GTCGGCAGCGAGAGCAAGCACGG - Exonic
1146492354 17:33292133-33292155 GGCGGCAGCGGCGGCGGCCCCGG + Exonic
1147613130 17:41812993-41813015 GCCGGCAGTGAGGGCGAGCGAGG - Exonic
1147830804 17:43297242-43297264 GGAGGCGGCGAGGGCCAGCAAGG + Intergenic
1148467239 17:47872510-47872532 GGCGGCGGCGATGGGGAGGAGGG + Intergenic
1149914897 17:60600057-60600079 GGCGGGAGCGAAGGCGGGGACGG + Intergenic
1150326458 17:64262529-64262551 GCCAGCAGCGACGGCGTCCACGG + Intronic
1150830345 17:68512785-68512807 GGGGGCAGCGAGCGCGAGCGGGG - Intronic
1151723254 17:75870125-75870147 GGCGGCAGCGCTGGGAAGCAGGG + Intergenic
1151812595 17:76453172-76453194 GGCGACAGCGGCGGCGAACGAGG + Exonic
1152433106 17:80260513-80260535 GCCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433120 17:80260543-80260565 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433133 17:80260573-80260595 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433146 17:80260603-80260625 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433159 17:80260633-80260655 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433172 17:80260663-80260685 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433185 17:80260693-80260715 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433198 17:80260723-80260745 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433211 17:80260753-80260775 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433224 17:80260783-80260805 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152433237 17:80260813-80260835 GGCGGCGGCGGCGGCGGGCAGGG + Intergenic
1152449872 17:80371362-80371384 TGCTGCAGCGATGGGGAGCAGGG + Intronic
1154954730 18:21242617-21242639 GGCGGCAGGGAAGGCAGGCACGG - Intronic
1155392721 18:25352308-25352330 GGCGGCGGCGGCGGCGGGCGGGG - Intergenic
1156446940 18:37243913-37243935 GGCGGCGGCGGCGGCGACCCGGG + Exonic
1156452165 18:37273083-37273105 GGCGGCAGCGAAGGCAGCCATGG + Exonic
1157196115 18:45621567-45621589 GGAGGAAGCGACTGTGAGCAAGG - Intronic
1157545131 18:48541113-48541135 GAAGGCAGCGGCGGCGAGCGCGG - Intronic
1160025013 18:75209477-75209499 GGCGGGGGGGACGGCGGGCAAGG + Intergenic
1160931970 19:1575069-1575091 GGCGGCAGCGGTGGGGAGCTTGG + Intronic
1160948030 19:1652412-1652434 GGCGGCGGCGGCGGCGCGCGTGG + Intronic
1161703242 19:5805934-5805956 GGCGGCGGCGGCGGCGAGCAGGG - Intergenic
1162470915 19:10871634-10871656 GGCGGCAGCGGCGGCGGCCTGGG + Exonic
1162751793 19:12833945-12833967 GGCGGCAGCGGCGGCGACTTCGG - Intronic
1162778629 19:12995509-12995531 GGCGGCGGCGGCGGCGGGCGAGG + Intergenic
1162954498 19:14090775-14090797 GGCGGCGGCGGCGGCGGGGAGGG - Intronic
1163424259 19:17232469-17232491 GGAGGCAGGGACCGCGCGCAGGG + Exonic
1163426865 19:17245087-17245109 GCCGCCAGCGACGCCGAGCCGGG - Exonic
1163828341 19:19535970-19535992 GGCGGCAGCCAGGGCGGGCGCGG - Exonic
1165431419 19:35775589-35775611 GGCGGCAGCGGCGACGAGAACGG + Exonic
1168301507 19:55407577-55407599 GGCCGCAGCCATGGTGAGCACGG - Exonic
1168544728 19:57240845-57240867 GGCGGGGGCTGCGGCGAGCAGGG - Intronic
928983213 2:37156898-37156920 GGCGGCGGCGCAGGTGAGCAGGG - Exonic
929778343 2:44942240-44942262 GGCGGCAGCGGCGGCGGGAACGG + Exonic
931392182 2:61853903-61853925 GGCGGCAGCGGAGGCGATCTTGG - Exonic
932880125 2:75493435-75493457 GACAGCAGCGACAGCGAGGATGG - Exonic
934011581 2:87825464-87825486 GGCGGCGGCGACGGCGGCCTCGG - Intronic
934966829 2:98731012-98731034 GGCGGCAGCGGCGGCGCGCGGGG - Intronic
935346210 2:102110889-102110911 GGCTGCAGAGACAGCGAGTAGGG + Intronic
935532216 2:104248087-104248109 GGAGGCTGCGACAGGGAGCAGGG + Intergenic
937283465 2:120735976-120735998 GGCGGCTGCGACTGCGAACGCGG + Intronic
938796052 2:134718956-134718978 GGCGGCGGCGACGACAAGCGCGG + Exonic
939629758 2:144517165-144517187 GGCGGCGGCGGCGGCGCCCAGGG - Intronic
941666421 2:168247539-168247561 GGCGGCGGCGGCGGCGGGCGGGG - Exonic
942454827 2:176130420-176130442 GGCGGCGGCGGCGGCGGGCGAGG + Exonic
944412445 2:199457730-199457752 GGCGGCGGCGGCGGCGAGCCGGG + Exonic
945431662 2:209772006-209772028 GGCGGCGGCGGCGGCTAGCGAGG + Exonic
947103720 2:226647859-226647881 GGAGGCACCGAGAGCGAGCAAGG - Intergenic
947641156 2:231708576-231708598 GGAGGCGGCTGCGGCGAGCAAGG - Exonic
947716642 2:232343079-232343101 GGCGGCAGTGCCGGGGAACATGG - Intronic
948140473 2:235669493-235669515 GGCGGCGGCGGCGGCGAGCGCGG - Intronic
948945687 2:241217948-241217970 GGGGGCAGCGGGGGCGCGCAGGG + Intronic
948945701 2:241217978-241218000 GGGGGCAGCGGGGGCGCGCAGGG + Intronic
948945746 2:241218067-241218089 GGGGGCAGCGGGGGCGCGCAGGG + Intronic
948945763 2:241218100-241218122 GGGGGCAGCGGGGGCGCGCAGGG + Intronic
948945787 2:241218153-241218175 GGGGGCAGCGGGGGCGCGCAGGG + Intronic
1169274204 20:4221957-4221979 GGCGGCGGCGCCGGCGACGACGG + Exonic
1170524564 20:17226010-17226032 GGGCGCAGCGACGGGGGGCAGGG - Intergenic
1172684905 20:36746106-36746128 GGCGGCGGCGGCGGCGAGAGGGG + Intergenic
1173506363 20:43590438-43590460 GGCTTGAGCGCCGGCGAGCATGG - Intergenic
1173827717 20:46058055-46058077 GGCGGCGGAGACGGCAAGCGCGG - Intronic
1176062253 20:63177609-63177631 GGCGGCGGCGGCGGCGGGCGCGG + Intergenic
1176068933 20:63216057-63216079 GGCGGCAGCGGCGGTGAGCCCGG + Exonic
1176232296 20:64038645-64038667 GGCCGCCGCGACGCCGGGCAGGG - Intronic
1176234560 20:64048419-64048441 GGCGGCGGCGACAGCGGGCCGGG + Exonic
1177871087 21:26573272-26573294 GGTGGCAACGACTGCGGGCAGGG + Exonic
1178493818 21:33070821-33070843 GCCGGGCGCGGCGGCGAGCAGGG - Exonic
1178861765 21:36295745-36295767 GGCGGCAGCGGCGGCGATACGGG - Intergenic
1180949416 22:19714473-19714495 GGCGGCGGCGGCGGCGCGGAGGG + Exonic
1180961932 22:19766176-19766198 GGCGGCGGCGGCGGCGGGCGGGG - Intronic
1181299184 22:21867413-21867435 GGCGGCGGCGGCGGCGGGCGCGG - Exonic
1181851420 22:25752712-25752734 GGAGGCACCGAGAGCGAGCAAGG - Intronic
1184173546 22:42773072-42773094 GGCTGCAGGGACGGACAGCAGGG - Intergenic
1184337499 22:43862387-43862409 GGCGGCGGCGACGGCGACGGCGG - Exonic
1184412232 22:44331882-44331904 GGCGGCGGCGGCGGCGGGCGCGG - Intergenic
1184412245 22:44331925-44331947 GGCGGCGGCGGCGGCGAGCGCGG - Intergenic
1184771548 22:46599806-46599828 TGCTCCAGCGACGGCGACCATGG - Intronic
1185132851 22:49049853-49049875 AGCGGCAGAGACAGGGAGCACGG + Intergenic
1185335797 22:50270387-50270409 GGCGGCGGCGGCGGCGGGCGGGG + Exonic
950308272 3:11933682-11933704 GGAGCCAGAGAGGGCGAGCAAGG + Intergenic
950829552 3:15860033-15860055 GGCGGCAGCGCCTGGGAGCCGGG - Intergenic
951485288 3:23203241-23203263 GGCGGCAGCGGCGGCGCTGAGGG + Intronic
952076242 3:29701429-29701451 GGAGGCACCGAGGGCGAGCGAGG - Intronic
954004221 3:47578871-47578893 GGCGGCAGCGGCGGCGCGGGAGG - Exonic
954110112 3:48429012-48429034 CCCGGCGGCGACGGCGAGGAGGG + Intronic
954316234 3:49803251-49803273 GGCGGGAGCTACGGAGAGCGAGG + Exonic
955768565 3:62369056-62369078 GGCGGCGGCGGCAGCGAGCTCGG + Intergenic
956813550 3:72888062-72888084 GGCGGCGGCGACGGCGAAGGAGG - Exonic
958814504 3:98901314-98901336 GGCCGCCGCGATGGCGAGCCGGG - Exonic
960034197 3:113086540-113086562 GGGGGCAGGGAGGGCGGGCATGG + Intergenic
961735931 3:129002159-129002181 GGCGGCGGCGGCGGCGCGGACGG - Exonic
966182078 3:177197182-177197204 GGTGGCGGCGGCGGCGAGGAGGG - Intronic
968659645 4:1793715-1793737 GGCGGCGGCGGCGGCGGGCGGGG + Intronic
969340132 4:6535224-6535246 GGCAGCAGCGCCGGTGAGCTTGG - Intronic
970193564 4:13536051-13536073 GGCACCAGGGACTGCGAGCAGGG + Intergenic
971195757 4:24471027-24471049 CGCGCCAGCGCCGGCGAGCGCGG + Intergenic
971406032 4:26321262-26321284 GGCGGCGGCGGCGGCGAGGCCGG + Intronic
972765940 4:42152272-42152294 GGCGGCGGCGGCGGCGGCCACGG - Exonic
983940282 4:173529552-173529574 GGCGGCGGCGGCGGCGGCCAGGG - Exonic
985512523 5:320803-320825 GGCCCCAGCGAGGGCGAGAACGG + Intronic
985894452 5:2740233-2740255 GGAGGCAGCGACGGCCAGGGAGG - Intergenic
990210791 5:53480240-53480262 GCCGGCAGCGCCGGCGCGCCCGG - Intergenic
990955057 5:61332425-61332447 GGCGGCGGCGGCGGCGTGCGGGG + Exonic
993901345 5:93585657-93585679 GGAGGCAGCGGCAGCGAGCTGGG - Intronic
994353833 5:98773856-98773878 GGCGGCAGCAGCGGGGCGCAGGG - Intronic
994367134 5:98928931-98928953 GGCGGAGGCGACGGCGACCTCGG - Exonic
996055062 5:118973665-118973687 GGAGGCGGCTGCGGCGAGCAAGG - Intronic
999096033 5:148978991-148979013 GGAGGCAGGGACGGGGAGGAGGG + Intronic
999252012 5:150188399-150188421 GGCCACAGGGACAGCGAGCAGGG - Intergenic
999322615 5:150624748-150624770 GGCGGTGGCGGCGGCGAGGAGGG + Intronic
1001030260 5:168257462-168257484 GGCAGGAGCGAGGGAGAGCATGG + Intronic
1001035091 5:168291779-168291801 AGCGGCAGCGGCGGCGTGGAGGG + Intronic
1002455893 5:179345197-179345219 GTCGGCGGCGGCGGCGAGCCTGG + Exonic
1002556591 5:180046346-180046368 GGAGGCACCGAGAGCGAGCAGGG + Intronic
1002898160 6:1390851-1390873 GGCGGCGGCGGCGGCGACTACGG + Exonic
1003624088 6:7727044-7727066 GGCGGCCGCGGCAGCGGGCAAGG - Exonic
1004425585 6:15504853-15504875 GGAGACAGTGACGGGGAGCAGGG - Intronic
1004504726 6:16238650-16238672 GGCGGCGGCGACGGCGGGGCGGG - Exonic
1004690347 6:17987692-17987714 GGCGGCGGCGGCGGCGGGCGGGG + Intergenic
1006077293 6:31541971-31541993 GGCGGCAGCAACAGCGACGAAGG + Exonic
1006436833 6:34030078-34030100 GGCAGGAGAGACGGCCAGCACGG - Intronic
1007432877 6:41786633-41786655 GGCGGCGGCGGCGGCGCGCACGG + Intronic
1007557820 6:42782020-42782042 GGCGGCGGCGGCGGCGGGCGCGG - Exonic
1007600141 6:43076281-43076303 GGCGGCGGCGGCGGCGCGCGGGG + Intronic
1011416252 6:87122770-87122792 GGCGGCGGCGGCGGCGGGCCTGG + Intergenic
1013117564 6:107114738-107114760 GGCGGCGGCGGCGGCGCGGACGG + Intronic
1014947520 6:127515789-127515811 GGCGGCAGCGGCGGCGGCCGCGG - Exonic
1015625933 6:135181183-135181205 GGCGGCAGCCAGGGCGACCGCGG + Intergenic
1017672398 6:156779256-156779278 GGCGGCGGCGGCGGCGCGCTGGG - Exonic
1018361760 6:163077911-163077933 GGCGGCAGAGATGGAGAGAATGG + Intronic
1019436913 7:1027302-1027324 GGCTGCAGAGACGGCGGGAATGG - Intronic
1020418202 7:7969439-7969461 GGCGGCGGCGACGGCGGGCGGGG - Exonic
1021106715 7:16646258-16646280 GGAGGTAGCGACGACGCGCAAGG - Exonic
1022097670 7:27150980-27151002 GGCAGCAGCGAGCGCCAGCACGG + Intronic
1022101086 7:27169588-27169610 GGCGGCGGCGGCGGCGGGCGAGG - Intronic
1022230710 7:28409938-28409960 GGCAGCGGAGACGGCGAGCCAGG + Intronic
1022285970 7:28956544-28956566 GGCGGCAGCGACGGAGGGGCTGG + Exonic
1023773687 7:43583331-43583353 GGCGGCGGCGGCGGCCGGCACGG - Exonic
1023955715 7:44885317-44885339 GGCGACAGCGGCAGCGAGCGCGG - Exonic
1026471246 7:70695129-70695151 GGCGGCCGGGCCGGCGGGCAGGG + Intronic
1028986134 7:97009901-97009923 GGAGGCAGCGCTGGCGAGCGTGG - Exonic
1029456206 7:100673809-100673831 GGCGGCGGCGGCGGCGCGGATGG - Exonic
1032391162 7:131556277-131556299 GGCGACGGCGACGGCGACGACGG + Exonic
1033253184 7:139777799-139777821 GGCGGCGGCGGCGGCGCGCCCGG - Intronic
1033839996 7:145361142-145361164 GGAGGCACCGAGAGCGAGCAAGG + Intergenic
1034147252 7:148884205-148884227 GGCGGCGGCGGCGGCGCGCGGGG - Exonic
1034306279 7:150047658-150047680 GGCGGCGGCGGCGGCGCGGATGG - Intergenic
1034617365 7:152430107-152430129 GGCGGCAGCCACAGTGAGCCAGG + Intronic
1035169559 7:157010019-157010041 GGCGGCACGGGCGGCGGGCACGG - Exonic
1035221531 7:157409317-157409339 GGCAGCAGCGGCGGCGCCCACGG - Intronic
1035581039 8:738985-739007 GGCGGCGGCGGCGTCGCGCAGGG - Intergenic
1036801293 8:11794658-11794680 GGAGGCACCGAGAGCGAGCAAGG - Intergenic
1036831302 8:12022515-12022537 GGAGGCACCGAGAGCGAGCAAGG - Intergenic
1038883663 8:31640284-31640306 GGCGGCGGCGGCGGCGGGCGAGG + Intronic
1039048658 8:33473173-33473195 GGCGGCCGCGCGGGCGAGCTCGG + Exonic
1039542298 8:38382220-38382242 GGCGGCGGCGGCGGCCAGCACGG - Exonic
1040504470 8:48034921-48034943 GGCTGCAGGGAGGGGGAGCAAGG - Intronic
1041910728 8:63086018-63086040 CGCAGCAGCGGCGGCGGGCATGG - Exonic
1043484665 8:80687338-80687360 AGCGGCGGCGACGGCGTGGACGG + Exonic
1043769721 8:84183345-84183367 GGCGGCGGCGACGGGGAGCCTGG - Intronic
1043847258 8:85177426-85177448 GGCGGCAGAGCCCGCGAGCTCGG + Exonic
1044633560 8:94300841-94300863 GGAGGCACCGAGAGCGAGCAAGG + Intergenic
1049643903 8:143727677-143727699 AGCGGCTGCCACGGCGAGGATGG - Exonic
1049762274 8:144336903-144336925 GGCGGCGGCGGCGGCGGGCGGGG + Intergenic
1051170172 9:14313771-14313793 GGCGGCGGCCTCGGCAAGCACGG - Intronic
1051431240 9:16983200-16983222 GGCGGCAGGGACGGGTGGCAGGG - Intergenic
1052048535 9:23821703-23821725 GGCGGCGGCGGCGGCGGGAAAGG + Intronic
1053050611 9:34958220-34958242 GGCGGCGGCGGCGGCGCGCGCGG - Intronic
1053180052 9:35960995-35961017 GGAGGCAGCTAGGGAGAGCAAGG + Intergenic
1054738427 9:68780079-68780101 GGCGGCAGCGGCGGCGGCCCTGG + Exonic
1055044551 9:71910983-71911005 GGCGGCGGCGGCTGCGACCACGG - Intergenic
1055091120 9:72365291-72365313 GGCGGCGGCGGCGGGGAGCGCGG + Intergenic
1055513888 9:77018787-77018809 GGCGGCAGCTGCGGCGCGGACGG + Intergenic
1056555726 9:87685591-87685613 GGTGGGAGAGACGGGGAGCAGGG + Intronic
1057208193 9:93185367-93185389 GGCGGCGGCGACCGTGAGGAAGG + Exonic
1057358021 9:94347653-94347675 GGAGGCAGCCGCGGCGAGCAAGG + Intergenic
1057488630 9:95506090-95506112 AGCGGCAGCGGCGGCGGGCCCGG + Intronic
1057649728 9:96909964-96909986 GGAGGCAGCCGCGGCGAGCAAGG - Intronic
1059208230 9:112486668-112486690 GGCAGCAACGACTGCGAGCTCGG + Intronic
1059414802 9:114155989-114156011 GGCGGCGGCGGCGGCGCGCGGGG + Exonic
1060268559 9:122126240-122126262 GGCGGCAGAGGCAGCGGGCAGGG + Intergenic
1060389811 9:123268271-123268293 GGCGGCCGAGGCGGAGAGCAGGG - Intronic
1060700750 9:125747378-125747400 GGCGGCGGCGGCGGCGACGAGGG - Intronic
1061453495 9:130681599-130681621 GGCGGCGGCGGCGGCGAGCGCGG - Exonic
1062105767 9:134753953-134753975 GGCGGCAGCGACGGCGAGCATGG + Intronic
1062230609 9:135479822-135479844 GGCGGCAGCGGCGGCGCGCGGGG + Exonic
1062567315 9:137168967-137168989 GGAGGCGGCGGCGGCGCGCACGG + Exonic
1185763178 X:2703919-2703941 GGTGACAGGGACGGAGAGCAGGG + Intronic
1189324597 X:40105104-40105126 AGCGGCGGCGGCGGCGAGGAGGG + Intronic
1189418484 X:40834632-40834654 GGCGGCAGCGACGGCAGCGACGG + Intergenic
1189988473 X:46574031-46574053 GGCGGCCGCGACGGGGACAAGGG + Exonic
1192034377 X:67546551-67546573 GGCGGCGGCGGCGGCGAGGCGGG + Exonic
1192147791 X:68693610-68693632 GGAGGGAGCGTCGGCGAGTAGGG - Intronic
1199500385 X:148500727-148500749 GGCGGCAGCGGCGGCGGGGGCGG - Exonic