ID: 1062105768

View in Genome Browser
Species Human (GRCh38)
Location 9:134753956-134753978
Sequence GGCAGCGACGGCGAGCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062105757_1062105768 18 Left 1062105757 9:134753915-134753937 CCTTGCCTTCGCTGTCTGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1062105768 9:134753956-134753978 GGCAGCGACGGCGAGCATGGAGG 0: 1
1: 0
2: 0
3: 13
4: 110
1062105763_1062105768 -10 Left 1062105763 9:134753943-134753965 CCCGTTCTCCGGCGGCAGCGACG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1062105768 9:134753956-134753978 GGCAGCGACGGCGAGCATGGAGG 0: 1
1: 0
2: 0
3: 13
4: 110
1062105759_1062105768 13 Left 1062105759 9:134753920-134753942 CCTTCGCTGTCTGGTGGGCGCCT 0: 1
1: 0
2: 1
3: 3
4: 77
Right 1062105768 9:134753956-134753978 GGCAGCGACGGCGAGCATGGAGG 0: 1
1: 0
2: 0
3: 13
4: 110
1062105762_1062105768 -7 Left 1062105762 9:134753940-134753962 CCTCCCGTTCTCCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1062105768 9:134753956-134753978 GGCAGCGACGGCGAGCATGGAGG 0: 1
1: 0
2: 0
3: 13
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062105768 Original CRISPR GGCAGCGACGGCGAGCATGG AGG Intronic
900083627 1:876349-876371 GGGAGCGTGGGCGAGTATGGGGG - Intergenic
900083633 1:876369-876391 GGGAGCGTGGGCGAGTATGGGGG - Intergenic
900101808 1:965147-965169 GACAGCGTCGGGGAGGATGGCGG - Exonic
900438593 1:2642686-2642708 GGCAGCGCCAGCGAGAAAGGCGG - Intronic
900604244 1:3516762-3516784 GACAGGTACGGCGAGCACGGTGG - Intronic
904441578 1:30535274-30535296 GGGAGGGAGGGAGAGCATGGCGG - Intergenic
912915609 1:113811933-113811955 GGCAGCGACAGCGGGCCCGGCGG + Exonic
920956386 1:210623540-210623562 GGAATCGACGGCGAGCTTGTGGG - Exonic
921023836 1:211259708-211259730 AGCAGCGACGACGAGCACGGTGG + Exonic
922581790 1:226703584-226703606 GGCACCGCCGCCGAGCATGCCGG - Intronic
923474086 1:234316609-234316631 GCCAGCGATGGCGAGGATGGCGG - Exonic
923657835 1:235933621-235933643 GGCAGCAGGGGCAAGCATGGTGG - Intergenic
1064474793 10:15676138-15676160 GGCAGCGTAGGTGAGAATGGAGG - Intronic
1066351676 10:34642165-34642187 GGCAGGGACTGTGTGCATGGGGG - Intronic
1067937654 10:50624789-50624811 GCCAGGGACGGCGGGCATCGGGG - Intronic
1072731493 10:97849961-97849983 GGCGGCGGCGGCGGGGATGGGGG - Intergenic
1075313519 10:121433846-121433868 GGCAGAGGTGGAGAGCATGGAGG + Intergenic
1075627361 10:123972595-123972617 GGCAGCGATGGGGAGAAGGGAGG + Intergenic
1079064339 11:17276593-17276615 GGCCGCGCCGGGGAGCCTGGAGG - Intronic
1083656992 11:64234582-64234604 GGCAGCGGCGGCGGGGACGGCGG - Exonic
1083768574 11:64853981-64854003 TGCAGCGACTGCGACCGTGGGGG - Exonic
1085325159 11:75601042-75601064 GGCAGCAGAGGGGAGCATGGTGG + Intronic
1089234377 11:117010586-117010608 GGCAGGGACTGGGAGCATGGTGG - Intronic
1090832359 11:130428269-130428291 GGCGGGGGCGGGGAGCATGGGGG + Exonic
1092518442 12:9240427-9240449 GGCGGCTGCGGCGAGCAAGGAGG + Intergenic
1092796037 12:12111029-12111051 GGCGGCTGCGGCGAGCAAGGAGG - Intronic
1107725307 13:43293072-43293094 GGCAGCCATGGTGAGGATGGTGG - Intronic
1110965481 13:81689934-81689956 GGCGGCTGCGGCGAGCAAGGAGG - Intergenic
1113457264 13:110457634-110457656 AGCAGGGACGGTGAGCCTGGGGG - Intronic
1116828289 14:49693179-49693201 GCCAGCGACGGCGCGAATGGCGG + Exonic
1119535046 14:75396056-75396078 GGCAGGGACGGAGGGCAGGGAGG + Intergenic
1121308692 14:92923355-92923377 GACAGCGGCGGAGCGCATGGCGG - Exonic
1122672858 14:103385452-103385474 GGCAGCGGCGGCCAGCAGGGCGG + Intronic
1122783246 14:104152571-104152593 GGAGGGGACGGCGGGCATGGGGG + Intronic
1130115307 15:81000963-81000985 GGCGGCGGCGGCGAGCCCGGGGG + Exonic
1130370593 15:83283413-83283435 GGCGGCGGCGGCGAGGCTGGGGG - Intronic
1131108751 15:89751232-89751254 GGCAGCGGCGGCGCGTCTGGGGG + Exonic
1133213174 16:4274013-4274035 GGCAGGGACGGGGACCCTGGCGG + Intergenic
1136577669 16:31133963-31133985 GGCAGCATCGGGGAGCATGGTGG - Intronic
1143517315 17:7426384-7426406 AGCAGCGACGGCGACAACGGCGG - Exonic
1144946528 17:18972212-18972234 GGCAGCTCCAGGGAGCATGGGGG + Intronic
1145790475 17:27623701-27623723 GGCACTGACGGCCAGGATGGCGG + Exonic
1147905842 17:43822609-43822631 GGCAGCCACGGGGAGGAGGGTGG - Intronic
1150830344 17:68512782-68512804 GGCAGCGAGCGCGAGCGGGGCGG - Intronic
1151815596 17:76469992-76470014 GGCAGAGACGGGGATCATGTTGG - Exonic
1152001013 17:77645234-77645256 GGCAGCCACCGGGAGCGTGGAGG - Intergenic
1152433108 17:80260516-80260538 GGCGGCGGCGGCGGGCAGGGCGG + Intergenic
1152433121 17:80260546-80260568 GGCGGCGGCGGCGGGCAGGGCGG + Intergenic
1152433134 17:80260576-80260598 GGCGGCGGCGGCGGGCAGGGCGG + Intergenic
1152433147 17:80260606-80260628 GGCGGCGGCGGCGGGCAGGGCGG + Intergenic
1152433160 17:80260636-80260658 GGCGGCGGCGGCGGGCAGGGCGG + Intergenic
1152433173 17:80260666-80260688 GGCGGCGGCGGCGGGCAGGGCGG + Intergenic
1152433186 17:80260696-80260718 GGCGGCGGCGGCGGGCAGGGCGG + Intergenic
1152433199 17:80260726-80260748 GGCGGCGGCGGCGGGCAGGGCGG + Intergenic
1152433212 17:80260756-80260778 GGCGGCGGCGGCGGGCAGGGCGG + Intergenic
1152433225 17:80260786-80260808 GGCGGCGGCGGCGGGCAGGGCGG + Intergenic
1152433238 17:80260816-80260838 GGCGGCGGCGGCGGGCAGGGCGG + Intergenic
1162725204 19:12686140-12686162 GGGAGGGAGGGCCAGCATGGTGG - Intergenic
1163424260 19:17232472-17232494 GGCAGGGACCGCGCGCAGGGCGG + Exonic
1163606929 19:18280834-18280856 GGCAGCGAAGGCGACCGTCGCGG + Exonic
1165242758 19:34481367-34481389 TGCAGCGCCGGAGAGCAAGGCGG + Intergenic
1165681495 19:37779931-37779953 GGCCGCGAGGGCGAGCGTGGGGG + Intronic
1165923646 19:39314184-39314206 GGAAGCGACGGCGCCCGTGGAGG - Exonic
931392181 2:61853900-61853922 GGCAGCGGAGGCGATCTTGGAGG - Exonic
931672288 2:64658423-64658445 GTCAGCCACAGCGAGCAGGGAGG + Intronic
935745111 2:106183618-106183640 GGCAGTGACGGCCAGCAAGTGGG - Intronic
945225832 2:207530365-207530387 GCCAGCGGCGGCGCTCATGGCGG + Intronic
947641155 2:231708573-231708595 GGCGGCTGCGGCGAGCAAGGAGG - Exonic
947669285 2:231926282-231926304 GGCAGCGAGGGCGCGCAGGTCGG + Exonic
947716641 2:232343076-232343098 GGCAGTGCCGGGGAACATGGAGG - Intronic
948140472 2:235669490-235669512 GGCGGCGGCGGCGAGCGCGGCGG - Intronic
1173506362 20:43590435-43590457 TTGAGCGCCGGCGAGCATGGCGG - Intergenic
1176021235 20:62963404-62963426 GGCAGGGCCGGTGACCATGGGGG + Intronic
1178330825 21:31689640-31689662 GGCGGTGAGGGTGAGCATGGTGG + Intronic
1178641355 21:34346798-34346820 TGCAGCGAGGCCGGGCATGGTGG + Intergenic
1179827344 21:43973583-43973605 GGCAGCGGCAGGGAGGATGGCGG - Intronic
1182063955 22:27417283-27417305 GGCAGCCAGGGGGAGCACGGAGG - Intergenic
1184097281 22:42323338-42323360 GGCAGCCAGGGCCAGCATGGAGG + Intronic
951312031 3:21138676-21138698 GGAAGCAAGGGCGAGCAAGGAGG - Intergenic
954662211 3:52232183-52232205 GGCAGCCACGGCGAGGCTGGAGG - Intronic
956175750 3:66471568-66471590 AGCAGGGACGGAGGGCATGGCGG + Intronic
958441914 3:94165483-94165505 GGCAGTGACTGTGAGCATGAAGG - Intergenic
960034198 3:113086543-113086565 GGCAGGGAGGGCGGGCATGGTGG + Intergenic
962350159 3:134650681-134650703 GGAAGCGACGGCAGCCATGGGGG + Intronic
964857405 3:161161815-161161837 GCCAGCGACTGGGAGCATGTTGG - Intronic
968815162 4:2818208-2818230 GCCAGGGCCGGCGGGCATGGCGG + Exonic
971195758 4:24471030-24471052 GCCAGCGCCGGCGAGCGCGGCGG + Intergenic
987114069 5:14712895-14712917 CGCAGCGATGGCGACCATGGTGG + Exonic
988777686 5:34491687-34491709 GGCAGCGACGGGGTAAATGGGGG + Intergenic
992460994 5:76960157-76960179 GACAGTGACTGGGAGCATGGGGG + Intronic
995403307 5:111765654-111765676 GGCAACGAAGGTGAGCATGACGG - Intronic
996055061 5:118973662-118973684 GGCGGCTGCGGCGAGCAAGGAGG - Intronic
998200445 5:140114194-140114216 GACAGCGGCAGCGAGCAGGGTGG + Exonic
999016784 5:148115521-148115543 GGCAGCTACGCAGAGCAAGGAGG + Intronic
1001065120 5:168529706-168529728 GGCGGCGACGGCAAGGATCGCGG + Exonic
1004340129 6:14801023-14801045 GGCACCAATGGCGAGCATGGTGG + Intergenic
1011613949 6:89180975-89180997 GGCAGCTAGGTCCAGCATGGTGG - Intronic
1017946479 6:159100346-159100368 GGCAGTGACAGGGAGGATGGAGG - Intergenic
1019693746 7:2432912-2432934 GCCTGCGCCGGGGAGCATGGAGG + Exonic
1022096241 7:27143255-27143277 GGCAGCGACAGCCACCACGGCGG - Exonic
1024382806 7:48718548-48718570 GCCAGCAATGGCTAGCATGGGGG - Intergenic
1027171987 7:75879067-75879089 GGGAACGACGGCGGCCATGGCGG + Exonic
1032482194 7:132256128-132256150 GGCAGTGAGGCCCAGCATGGTGG + Intronic
1035948761 8:3995014-3995036 GACAGGGACGGGGAGCATTGTGG - Intronic
1036723768 8:11201245-11201267 GGCAGCGGCGGCGAGGAGGACGG - Exonic
1039542297 8:38382217-38382239 GGCGGCGGCGGCCAGCACGGAGG - Exonic
1040677211 8:49765206-49765228 GGCAGGGGCGGCGGGCAGGGGGG - Intergenic
1044858050 8:96495198-96495220 GCCAGAGAGGGCGAGCGTGGCGG - Intronic
1049643900 8:143727674-143727696 GGCTGCCACGGCGAGGATGGGGG - Exonic
1050744156 9:8857788-8857810 GGCGGCGGCGGCGACCAGGGGGG - Intronic
1054453061 9:65413491-65413513 GGCAGTTACAGCGAGCCTGGGGG - Intergenic
1057428315 9:94972107-94972129 GGCAGGGACGGTGACCGTGGTGG + Intronic
1060738279 9:126080416-126080438 GGCTGCAAAGGGGAGCATGGTGG - Intergenic
1060828992 9:126702150-126702172 GGCAGGGATGGGGAGTATGGTGG + Intergenic
1062105768 9:134753956-134753978 GGCAGCGACGGCGAGCATGGAGG + Intronic
1062189972 9:135242964-135242986 GGCTGCCAGGGCGGGCATGGGGG - Intergenic
1062230610 9:135479825-135479847 GGCAGCGGCGGCGCGCGGGGAGG + Exonic
1062449864 9:136610886-136610908 GGCAGGGAGGGCGGCCATGGGGG + Intergenic
1062449879 9:136610922-136610944 GGCAGGGAGGGCGGCCATGGGGG + Intergenic
1185508287 X:644536-644558 GGCGGCGGCGGCGACCACGGCGG - Exonic
1189310430 X:40014116-40014138 GGCGGCGACGGCGGGGGTGGGGG - Intergenic
1190878694 X:54477345-54477367 GGCAACGAGGGCGAGCCTGTGGG + Intronic
1192928990 X:75784923-75784945 GGCATCAACGACTAGCATGGAGG + Exonic
1197935334 X:131734667-131734689 GGCAAGGACGCCCAGCATGGAGG + Intergenic