ID: 1062105769

View in Genome Browser
Species Human (GRCh38)
Location 9:134753957-134753979
Sequence GCAGCGACGGCGAGCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 46}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062105762_1062105769 -6 Left 1062105762 9:134753940-134753962 CCTCCCGTTCTCCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1062105769 9:134753957-134753979 GCAGCGACGGCGAGCATGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 46
1062105757_1062105769 19 Left 1062105757 9:134753915-134753937 CCTTGCCTTCGCTGTCTGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1062105769 9:134753957-134753979 GCAGCGACGGCGAGCATGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 46
1062105764_1062105769 -10 Left 1062105764 9:134753944-134753966 CCGTTCTCCGGCGGCAGCGACGG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1062105769 9:134753957-134753979 GCAGCGACGGCGAGCATGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 46
1062105763_1062105769 -9 Left 1062105763 9:134753943-134753965 CCCGTTCTCCGGCGGCAGCGACG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1062105769 9:134753957-134753979 GCAGCGACGGCGAGCATGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 46
1062105759_1062105769 14 Left 1062105759 9:134753920-134753942 CCTTCGCTGTCTGGTGGGCGCCT 0: 1
1: 0
2: 1
3: 3
4: 77
Right 1062105769 9:134753957-134753979 GCAGCGACGGCGAGCATGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062105769 Original CRISPR GCAGCGACGGCGAGCATGGA GGG Intronic
900185694 1:1332169-1332191 GCAGCGACGACGAGTACGGCCGG + Exonic
900385064 1:2406754-2406776 GCAGCGGCAGCGAGCCAGGAAGG - Exonic
903446062 1:23423879-23423901 GCAGCGAGGGCGAGGGCGGAGGG - Intronic
905182593 1:36176265-36176287 GCTGCGACTCCGAGCAAGGAAGG - Exonic
905855514 1:41309034-41309056 GGAGAGACAGCGAGCAAGGAGGG - Intergenic
916581731 1:166115334-166115356 GGAGCGAGGGAGAGCATGCATGG + Intronic
922336796 1:224624568-224624590 GCAGGGATGGGAAGCATGGAAGG - Intronic
1072915157 10:99533261-99533283 TCAGCGGCGGCCAGCATGCAGGG - Exonic
1088080837 11:105910604-105910626 CCAGCGACGGTGAACAGGGAGGG + Intronic
1089541669 11:119193087-119193109 GCAGCAAGGGCCAGCATGAAGGG - Intronic
1101816838 12:108151996-108152018 GCAGCGACGCCGCCCTTGGAAGG - Intronic
1111882126 13:93970545-93970567 GCAGCAACAGTGGGCATGGAAGG - Intronic
1113576842 13:111401012-111401034 GCAGAGAGGGAGAGCAGGGATGG - Intergenic
1113655134 13:112063159-112063181 GGAGCGAGGGCGAGGAGGGAGGG - Intergenic
1113808373 13:113122956-113122978 GCAGCGCCAGGGAGCAGGGAGGG + Intronic
1121712826 14:96052224-96052246 GCAGAGACGGCCAGGCTGGAAGG - Intronic
1127261490 15:57329872-57329894 GCAGAGAAGGCCAACATGGAAGG - Intergenic
1136372533 16:29845323-29845345 CCAGGGACGAGGAGCATGGAAGG - Intronic
1143480930 17:7226984-7227006 GCAGCCAGGGCCACCATGGATGG - Intronic
1152449873 17:80371366-80371388 GCAGCGATGGGGAGCAGGGCAGG + Intronic
1154004593 18:10516250-10516272 GCAGCCAAGGCCAGCTTGGAGGG - Intergenic
936104738 2:109614475-109614497 GCAGCGCGGTCGAGGATGGAGGG + Exonic
947377368 2:229510323-229510345 GCAGCCACGTGGAGAATGGAGGG + Intronic
947716640 2:232343075-232343097 GCAGTGCCGGGGAACATGGAGGG - Intronic
1173506361 20:43590434-43590456 TGAGCGCCGGCGAGCATGGCGGG - Intergenic
1174352630 20:49979415-49979437 GGAGCGAGGGCGGGCCTGGAGGG + Intergenic
1177300021 21:19231733-19231755 GGAGCAACGGAGATCATGGAAGG + Intergenic
1179627398 21:42656384-42656406 GCAGAGACGGGGAGGAAGGAGGG + Intronic
1179709849 21:43206985-43207007 GCAGCCACTGGGAGCATTGATGG + Intergenic
1182063954 22:27417282-27417304 GCAGCCAGGGGGAGCACGGAGGG - Intergenic
1184097282 22:42323339-42323361 GCAGCCAGGGCCAGCATGGAGGG + Intronic
951312030 3:21138675-21138697 GAAGCAAGGGCGAGCAAGGAGGG - Intergenic
956175751 3:66471569-66471591 GCAGGGACGGAGGGCATGGCGGG + Intronic
986088892 5:4482284-4482306 GCAGGGATGGGGAGCCTGGATGG + Intergenic
997864707 5:137450847-137450869 GCAGCCACAGTGAGAATGGATGG - Intronic
1001159618 5:169301262-169301284 GGAGCGACCGAGAGCCTGGAGGG + Intergenic
1002313065 5:178326339-178326361 GCAGCGATGGCTTTCATGGAGGG - Intronic
1010464521 6:76151288-76151310 GCAGGGACGGCTGGCAGGGATGG + Intergenic
1016463794 6:144306263-144306285 GAAGCCACGTGGAGCATGGATGG + Intronic
1017946478 6:159100345-159100367 GCAGTGACAGGGAGGATGGAGGG - Intergenic
1019883305 7:3882341-3882363 GCAGGGAGGGCGACCTTGGATGG + Intronic
1022982887 7:35620958-35620980 GCAGCGACAGCGGGTATGGCTGG + Intergenic
1023095347 7:36654607-36654629 GCAGGGATGGAGAGGATGGATGG - Intronic
1029551065 7:101237364-101237386 CCAGAGAGGGCCAGCATGGACGG + Exonic
1030385842 7:108867147-108867169 GCAGAGACAGTGAGCTTGGAAGG + Intergenic
1047998405 8:130357972-130357994 GCGGCAGCGGCGAGCGTGGACGG + Intronic
1055645287 9:78357102-78357124 GCAGCGTGGTCGAGCGTGGAGGG + Intergenic
1062105769 9:134753957-134753979 GCAGCGACGGCGAGCATGGAGGG + Intronic