ID: 1062105773

View in Genome Browser
Species Human (GRCh38)
Location 9:134753983-134754005
Sequence CCAACTGCTGCATGTTTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062105766_1062105773 9 Left 1062105766 9:134753951-134753973 CCGGCGGCAGCGACGGCGAGCAT 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1062105773 9:134753983-134754005 CCAACTGCTGCATGTTTTCAAGG 0: 1
1: 0
2: 0
3: 16
4: 197
1062105763_1062105773 17 Left 1062105763 9:134753943-134753965 CCCGTTCTCCGGCGGCAGCGACG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1062105773 9:134753983-134754005 CCAACTGCTGCATGTTTTCAAGG 0: 1
1: 0
2: 0
3: 16
4: 197
1062105764_1062105773 16 Left 1062105764 9:134753944-134753966 CCGTTCTCCGGCGGCAGCGACGG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1062105773 9:134753983-134754005 CCAACTGCTGCATGTTTTCAAGG 0: 1
1: 0
2: 0
3: 16
4: 197
1062105762_1062105773 20 Left 1062105762 9:134753940-134753962 CCTCCCGTTCTCCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1062105773 9:134753983-134754005 CCAACTGCTGCATGTTTTCAAGG 0: 1
1: 0
2: 0
3: 16
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062105773 Original CRISPR CCAACTGCTGCATGTTTTCA AGG Intronic
901357234 1:8661539-8661561 CCAGCTGCTGCTTGTCTTCCCGG - Intronic
902296217 1:15468837-15468859 CCTACTGCTGCGTGTATCCATGG - Intronic
902998522 1:20247286-20247308 CCAACCAAGGCATGTTTTCAAGG + Intergenic
904833365 1:33319870-33319892 CAACCTACTGCAGGTTTTCAGGG + Intronic
904833772 1:33321951-33321973 CAACCTGCTGCAAGTTTGCAGGG - Intergenic
905803449 1:40860524-40860546 CAACCTGGTGCATGTTCTCATGG - Intergenic
907667746 1:56448138-56448160 CCCAGAGCTGAATGTTTTCAAGG - Intergenic
909596372 1:77411156-77411178 CAAACTGCTGCAAGTTTTGAAGG + Intronic
909837122 1:80270291-80270313 TCAACTTCTGCATGTGTTCTGGG + Intergenic
911780407 1:101869221-101869243 CCCACTTCAGCCTGTTTTCATGG - Intronic
912504523 1:110147081-110147103 CCAACTGCTGAATGTTCTGCAGG + Intergenic
913683253 1:121206963-121206985 CCAACTGCTGCACCTCTTCCTGG - Intronic
914035095 1:143994588-143994610 CCAACTGCTGCACCTCTTCCTGG - Intergenic
914154358 1:145073383-145073405 CCAACTGCTGCACCTCTTCCTGG + Intronic
914907983 1:151762390-151762412 CAAACAGCTTCTTGTTTTCAGGG + Exonic
915811786 1:158920718-158920740 CCCACTCCTGGCTGTTTTCATGG - Intergenic
917733344 1:177898146-177898168 CCAACAGCAGCGTGCTTTCAGGG - Intergenic
918141360 1:181722827-181722849 CCAACCTCTAGATGTTTTCAGGG - Intronic
918528131 1:185487246-185487268 CCAACTGCTGCATTCTCTCATGG - Intergenic
918695133 1:187536016-187536038 CTAACTTCTTCATGTTCTCATGG + Intergenic
919039467 1:192364679-192364701 CCATCTCCTGCATTTTTCCAAGG + Intronic
920470563 1:206225473-206225495 CCAACTGCTGCACCTCTTCCTGG - Intronic
920891581 1:209992438-209992460 TCAGATGCTGCATGTTCTCATGG + Intronic
922071091 1:222194140-222194162 GCAACTCTTCCATGTTTTCATGG + Intergenic
922561098 1:226570090-226570112 CCCCCTGCTGGATGTTTGCAGGG + Intronic
924036523 1:239943762-239943784 CCCACTCCTGGCTGTTTTCATGG + Intergenic
924202936 1:241679220-241679242 CCAACTGCTGTGTGCTTCCAGGG + Intronic
1063243878 10:4198450-4198472 CCAACTGAGTCATGTTTTCCAGG + Intergenic
1063811306 10:9711818-9711840 CCAGTTGCAGCAGGTTTTCATGG - Intergenic
1064106924 10:12508119-12508141 CCAGATGCTGCCTGTTCTCAGGG + Intronic
1066081192 10:31932256-31932278 TCAACTGCTTCTTGTTTCCATGG + Intergenic
1066350603 10:34633426-34633448 ACAAATACTGCCTGTTTTCACGG - Intronic
1066472136 10:35709439-35709461 CCAAATGCTGTATGTTCTCAGGG - Intergenic
1066752151 10:38668988-38669010 TCAAATGGTGCATGTTCTCAAGG - Intergenic
1066964879 10:42254064-42254086 TCAAATGGTGCATGTTCTCAAGG + Intergenic
1068222002 10:54057088-54057110 CCCACTCCTGGTTGTTTTCATGG + Intronic
1070088137 10:73256416-73256438 CCAACTGCTGCACTTTTTTCAGG - Exonic
1071332374 10:84572824-84572846 CCAACTCATGCAGGTTTTCTTGG + Intergenic
1073489489 10:103843614-103843636 CCAACCACATCATGTTTTCAGGG + Intronic
1073743822 10:106442709-106442731 CCAAATTCTGCATTTTATCATGG + Intergenic
1080266269 11:30405178-30405200 CCAAATGCTCCCTGTTTGCATGG - Intronic
1081544814 11:44064049-44064071 CCCCCTGCTGCATGTTTCCATGG + Intergenic
1081897209 11:46596881-46596903 CAAACTACTGCATGTTCTTATGG + Intergenic
1085281637 11:75334821-75334843 ACATCTGCTGCATGTCCTCAGGG - Intronic
1086742604 11:90386296-90386318 ACAAATGCTGCATCTTTACATGG - Intergenic
1086909711 11:92458223-92458245 CCCACTGCTGCAAGTCTCCAGGG - Intronic
1088850982 11:113703123-113703145 CCCACTTCTGGCTGTTTTCATGG - Intronic
1091399652 12:174302-174324 ACATCTGCTGCCTGATTTCATGG - Intronic
1092003342 12:5048836-5048858 CCAACTGCAGCCTGCTTTCTGGG - Intergenic
1095266037 12:40159035-40159057 CTAGCTGGTGCATGTTCTCATGG + Intergenic
1096147868 12:49291803-49291825 ACAACTATTGCATGTGTTCAGGG - Intergenic
1097344840 12:58479409-58479431 CCAACTTCTGCATGTTGACTGGG + Intergenic
1097654636 12:62344464-62344486 CCCACTCCTGGCTGTTTTCATGG + Intronic
1098992717 12:77082228-77082250 CCAAATACTGCATGTTCTCTGGG + Intergenic
1100596174 12:96074029-96074051 CCAACTGCTTCATGGGTACAGGG + Intergenic
1101918643 12:108915414-108915436 CCAAATACTGCATGTTCTCTGGG - Intronic
1103124768 12:118411799-118411821 CCAACTCCTGCTTCTTTTTAAGG + Intronic
1104891195 12:132140938-132140960 CCAGCTGCTGCAGCTTTTCAGGG + Exonic
1109562114 13:64063301-64063323 CCAACTGCTGCAGATTTTGTGGG - Intergenic
1109903814 13:68810893-68810915 CTAACTGCTGCCTGTATTCCTGG + Intergenic
1110453544 13:75664265-75664287 ACAAATACTGCATGTTCTCATGG - Intronic
1112483179 13:99795917-99795939 CCAACTGGTGCAGGTCTGCAGGG + Intronic
1112572434 13:100606366-100606388 CCAAATGCTGCAAGTTACCATGG - Exonic
1112844068 13:103616646-103616668 ACAACTGCTTTCTGTTTTCATGG + Intergenic
1116224384 14:42130155-42130177 TCAACTACTGCCTTTTTTCACGG - Intergenic
1116714117 14:48406754-48406776 CCCACTCCTGGCTGTTTTCATGG + Intergenic
1119179082 14:72592503-72592525 CCAGATGATGCATATTTTCAAGG + Intergenic
1121056195 14:90856064-90856086 CAAAGTGCTGTATGTTTCCATGG - Exonic
1121669983 14:95701662-95701684 GCTACTGTTGCATTTTTTCAGGG - Intergenic
1124994902 15:34713961-34713983 CCATCTGCTACATGTGCTCAGGG - Intergenic
1125882969 15:43209436-43209458 CAAACAGCTGCATTTTCTCAAGG - Exonic
1125908349 15:43414393-43414415 CCAACTGCTGCTGTGTTTCAGGG - Intronic
1125933168 15:43614273-43614295 CCAGCTGCTGGAGGTTTTCTGGG + Exonic
1125946266 15:43713735-43713757 CCAGCTGCTGGAGGTTTTCTGGG + Intergenic
1131003237 15:88955063-88955085 CCAACTCCTGCCAGTCTTCAGGG + Intergenic
1133759308 16:8785723-8785745 CCAGCTCCTGCCTGTTTTCTGGG - Intronic
1137633821 16:49968207-49968229 GCAATTGCTGAAGGTTTTCAGGG + Intergenic
1138575496 16:57904766-57904788 CCAGCTGCTGAATTATTTCACGG - Exonic
1138758613 16:59517765-59517787 CCAACTGCTGTCTGCCTTCAGGG - Intergenic
1138799260 16:60006746-60006768 CCATCTACTGGATGTTTTGATGG - Intergenic
1141401459 16:83750711-83750733 CCAGCTGCTGGAAGTTTACAGGG - Intronic
1145378127 17:22370686-22370708 CCACCTCCTGGCTGTTTTCATGG + Intergenic
1146903109 17:36600968-36600990 CAAACTCCTACATGTTTTCAAGG - Intergenic
1147673962 17:42192496-42192518 CGAACTTCTGGATGTTTTCTTGG - Exonic
1148166466 17:45487373-45487395 CCAACTCCTGCATCTTTCCCTGG + Intronic
1149356005 17:55839947-55839969 ACAACTGAAGCACGTTTTCAAGG + Intronic
1149971140 17:61219732-61219754 CCAGCTGCTGCTTGTTTAGATGG + Intronic
1150397635 17:64833773-64833795 CCAACTCCTGCATCTTTCCCTGG + Intergenic
1152299957 17:79489654-79489676 CCAACTGCAGCATTTCCTCAGGG + Intronic
1153601912 18:6789072-6789094 TGAACTGCGGCATTTTTTCAAGG - Intronic
1156583980 18:38411246-38411268 TAAACTGCTACATGTTTTCTAGG + Intergenic
1157942997 18:51949690-51949712 CCAACTGAGGAATGTTTTCATGG - Intergenic
1158118012 18:54018290-54018312 CCAGCTCCTGGATGTTTTCCTGG + Intergenic
1159248093 18:65836066-65836088 CCAAAAGCTGCATGTATTCTTGG - Intronic
1159261278 18:66016131-66016153 CCCACTGCTAGATGCTTTCATGG + Intergenic
1159606315 18:70478575-70478597 CCCACTCCTGGCTGTTTTCATGG - Intergenic
1159982621 18:74803915-74803937 TAAATTGCTTCATGTTTTCAAGG - Intronic
1160734810 19:657698-657720 CCAACTCCTGCGTATTGTCAGGG + Intronic
1161874399 19:6896555-6896577 CCAAATGCTGGATGGTTTGAGGG - Intronic
1163512505 19:17744061-17744083 GTAACTTCTGCATGTTGTCATGG + Intergenic
1165974735 19:39665829-39665851 CCACCTCCTGGCTGTTTTCATGG + Intergenic
1168320305 19:55505210-55505232 ACAACAGCTGCAGGATTTCAGGG + Intronic
925179040 2:1804826-1804848 CAAAGCGCTTCATGTTTTCAGGG + Intronic
925456015 2:4017293-4017315 CCCACTCCTGGATGCTTTCATGG + Intergenic
925572017 2:5322590-5322612 GCAAATCCTGCCTGTTTTCAAGG - Intergenic
928289650 2:30026188-30026210 CCAACAGCTGCATTTGCTCAGGG - Intergenic
928814991 2:35282977-35282999 CTAACTGCTACATCTCTTCAAGG - Intergenic
932833859 2:75016470-75016492 ACAAATGCTGCATGATCTCATGG + Intergenic
932919535 2:75894798-75894820 CCAGGCGCTGTATGTTTTCAAGG + Intergenic
933544017 2:83686564-83686586 TCAAATACTGCATGTTCTCATGG - Intergenic
934102668 2:88667768-88667790 CCCTCTTCTGCATGCTTTCAGGG + Intergenic
934315147 2:91911130-91911152 TCAAATGGTGCATGTTCTCAAGG - Intergenic
936712082 2:115143033-115143055 CCAAATGCTGGATTTTTTCTAGG - Intronic
937800661 2:126077236-126077258 CCAACTCCTGGCTGCTTTCATGG - Intergenic
938157869 2:128956888-128956910 CCATCTGCTCCTTGCTTTCAGGG + Intergenic
939000841 2:136732162-136732184 CCAACTGCTGCCAGCTCTCATGG - Intergenic
940613287 2:156018163-156018185 ACAACTTCTCCTTGTTTTCAGGG + Intergenic
943014746 2:182497341-182497363 TCAATTCCTGCATCTTTTCAGGG - Intronic
943852684 2:192746518-192746540 CCGACCTCTGCATTTTTTCATGG + Intergenic
945948593 2:216017664-216017686 CCATCAGCTGCTTGTTTCCAAGG + Intronic
947096762 2:226575481-226575503 GCAACTGATGCAGGTTTCCAAGG - Intergenic
948398040 2:237661940-237661962 CCAACACCTGCATGCTGTCATGG - Intronic
1169514690 20:6303125-6303147 TCAAATACTGCATGTTCTCATGG - Intergenic
1171264887 20:23763219-23763241 CCAGCTGCTCCATGATCTCAGGG - Intergenic
1171855665 20:30340537-30340559 CCACCTCCTGGCTGTTTTCATGG - Intergenic
1172867004 20:38108021-38108043 CCCACTGCTGTATGTGTTCCTGG - Intronic
1173414292 20:42842147-42842169 CCAACAGCAGCCTGGTTTCATGG + Intronic
1176956268 21:15107815-15107837 GCCACTGCTGTATGTTCTCAAGG - Intergenic
1178288865 21:31349469-31349491 ACAAATGGTGCATGTGTTCACGG + Intronic
1178498408 21:33105944-33105966 ACACCTGCTGGATGTTTTAAAGG + Intergenic
1178617747 21:34148141-34148163 TCCACTACTGCATTTTTTCAAGG - Intergenic
1179377347 21:40862489-40862511 GCTTCTGCTGCATGTTCTCATGG + Intergenic
1180541907 22:16457014-16457036 TCAAATGGTGCATGTTCTCAAGG - Intergenic
1180573713 22:16752874-16752896 CCACCTCCTGGCTGTTTTCATGG - Intergenic
1184751497 22:46488968-46488990 CCAACTGCTGCATGCTCAAAAGG - Intronic
953839817 3:46380603-46380625 CCAACAGCGGCATGTTTTGATGG + Intergenic
957963927 3:87297326-87297348 CCAAGTACTAAATGTTTTCATGG + Intergenic
958690596 3:97460816-97460838 TCAACAGCTGCATCTTTCCATGG + Intronic
961110496 3:124279351-124279373 CCATGTGCTGAATGTCTTCAAGG - Intronic
961110857 3:124281921-124281943 CCTACTGCTGAATGGTTTCTAGG + Intronic
962173165 3:133124532-133124554 CCAACTGCTGTGTGTGTTCCAGG + Intronic
964193850 3:154038632-154038654 CTATCTGCTGCAGGTTTGCAGGG - Intergenic
966299625 3:178463288-178463310 CCCTCTGCTGCCTGATTTCAAGG - Intronic
967143737 3:186587655-186587677 CCAACAGCAGCTTTTTTTCAAGG - Intronic
967824946 3:193870210-193870232 GCACCTGCTGCATGCTGTCAGGG - Intergenic
968040750 3:195587275-195587297 CCATCTGCTTTGTGTTTTCATGG + Intergenic
969475318 4:7419228-7419250 CCAACTGCTGAGTGCTTTCTGGG + Intronic
970449040 4:16148930-16148952 CCACCTGCTGCATGATTTTAGGG + Intergenic
970622598 4:17839414-17839436 CCAGTTGCTGCATGTTTTGGAGG - Intronic
973818531 4:54641302-54641324 CCAACTGTTGAATGTTTTAAAGG + Intergenic
975144327 4:70950999-70951021 CCAACAGCTCCATCTCTTCAAGG - Intronic
975423274 4:74195114-74195136 CAAAATGCCTCATGTTTTCAAGG + Intronic
976468249 4:85396136-85396158 CCAACTGTTGCTTGTGTTCAGGG + Intergenic
976723678 4:88194951-88194973 CCAACTGGTCTATGTTTTAAAGG + Intronic
977947387 4:102929220-102929242 TCAAATGGTGCATGTTCTCAAGG - Intronic
979667344 4:123326738-123326760 CCCACTGCTGCATGTGGCCAGGG + Intergenic
981024801 4:140066788-140066810 CCAACTGCTGCTTCCTTTCTGGG + Intronic
984047172 4:174815281-174815303 CCCACTCCTGGCTGTTTTCATGG + Intronic
985964435 5:3329284-3329306 CCAATGGCTGCATGCTTTTATGG + Intergenic
987169007 5:15233668-15233690 CCAACGTCGGCATGTGTTCAGGG - Intergenic
988031333 5:25767451-25767473 CAAACTACTGCATGTTGTGAGGG - Intergenic
988296000 5:29363068-29363090 CTAAATGCTGCATTTGTTCAAGG - Intergenic
988455215 5:31381565-31381587 CGAAATGCTACATGTTTACATGG - Intergenic
992610614 5:78505134-78505156 CAAACTGCTTGATGTTGTCATGG + Intronic
993415370 5:87622581-87622603 ACAACTGCAGCATTTTTTAATGG - Intergenic
994610347 5:102029796-102029818 CCAAGTGGTCTATGTTTTCATGG + Intergenic
997904962 5:137807419-137807441 CCAACTTCTGTATTTTTTTAGGG - Intergenic
998178162 5:139914791-139914813 CCAACATGGGCATGTTTTCAGGG - Intronic
999807370 5:155095147-155095169 CCAAATACTGCATGTTCTCATGG + Intergenic
1002457473 5:179353819-179353841 GCCAGAGCTGCATGTTTTCATGG - Intergenic
1002551851 5:180000038-180000060 CATACTCCTGCATGTTTTCCTGG + Intronic
1003072361 6:2955264-2955286 CCAACTGCTGGATCCTTTAAGGG + Intronic
1003252646 6:4444478-4444500 CAAATTGCTGCATGTATCCATGG + Intergenic
1005877194 6:30020108-30020130 CCAAATGCTGCATATTTACTAGG - Intergenic
1006791785 6:36706242-36706264 CCAACTGCTCCAGTTTTCCAAGG + Intronic
1007513385 6:42391761-42391783 CCCACTGCTCCATGTTCTGAGGG - Intronic
1007556971 6:42774259-42774281 CCAACAGCTCCATGGTTTGAGGG + Intronic
1007712245 6:43831907-43831929 CCAATGGCTACATGATTTCATGG - Intergenic
1007931031 6:45690640-45690662 CCAACCCCTGCATATATTCAGGG - Intergenic
1008517729 6:52334073-52334095 TCAACTGCTGCAGTTTTTCCTGG + Intergenic
1011860627 6:91751480-91751502 ACAACTGCTGCATTTTTACATGG - Intergenic
1012646229 6:101685461-101685483 CCACATGCTGGATGTTTTCATGG + Intronic
1012783843 6:103597834-103597856 CCAACTGCTGTCAGTTTACAGGG - Intergenic
1018029159 6:159828334-159828356 TCATCTGCTGCCTGTTTTTATGG + Intergenic
1019448659 7:1084605-1084627 CCAACTGCTGCTCCTTTTCAAGG - Intronic
1020176472 7:5886199-5886221 CAAACTGCAGAAGGTTTTCAGGG - Exonic
1027464100 7:78493191-78493213 CCACCTATTGCATATTTTCAAGG - Intronic
1028839038 7:95406788-95406810 CCTGCTGCTGCATGTAATCATGG + Intronic
1029082355 7:97984826-97984848 CAAACTGCAGAAGGTTTTCAGGG + Exonic
1029682316 7:102120040-102120062 CCTACTGCTGCGTGATTCCAGGG - Intronic
1031781869 7:125978396-125978418 GCAACTGAAGCCTGTTTTCAGGG + Intergenic
1032435615 7:131897944-131897966 CCAGCTGATCCATGTCTTCATGG + Intergenic
1033494425 7:141880071-141880093 TCAACTCTTGCATGTTTTAATGG + Intergenic
1034066537 7:148142212-148142234 CCAACTGCTGCACCTATACACGG - Intronic
1035187923 7:157140089-157140111 CCAACTGATGCCCGTCTTCAGGG - Intronic
1035912809 8:3586600-3586622 CCAACTTCCTCTTGTTTTCAGGG - Intronic
1036448221 8:8842091-8842113 CAGCCTGCTGCAGGTTTTCAAGG + Intronic
1038722633 8:30050839-30050861 CTAACTGATGCAAGTTGTCAGGG + Intergenic
1039377174 8:37046200-37046222 CCAATGGGTGCAAGTTTTCAAGG - Intergenic
1041696477 8:60741978-60742000 CCATCTGCTGCATGTGCTGAGGG - Exonic
1044249445 8:89988901-89988923 CCAGCTGCTTCATGTTGGCAGGG + Intronic
1045398579 8:101786759-101786781 CCAGCTGTTGCCTGTCTTCATGG - Intronic
1052240583 9:26267920-26267942 CCAACTGGTCCATATTTTAATGG + Intergenic
1056157463 9:83852503-83852525 CCTATTGCTGCATGTTTGGAGGG - Intronic
1056353081 9:85771596-85771618 CCTATTGCTGCATGTTTGGAGGG + Intergenic
1058184007 9:101832603-101832625 CTACCTGCTGTATGTTTACAGGG - Intergenic
1062105773 9:134753983-134754005 CCAACTGCTGCATGTTTTCAAGG + Intronic
1186750580 X:12617795-12617817 CCCATTGCAGCATGTGTTCATGG + Intronic
1196011930 X:110898063-110898085 CCCACTGCTGGCTGCTTTCATGG + Intergenic
1196209293 X:112977140-112977162 CCAACATCTGCATTTTTTCAAGG - Intergenic
1197253905 X:124242740-124242762 CCAAATCCTACCTGTTTTCAGGG + Intronic
1198608286 X:138368681-138368703 TCCACTGGTGCATCTTTTCATGG + Intergenic
1200054758 X:153454490-153454512 CCAGCTGCTGCAAGTGGTCATGG - Exonic
1201182818 Y:11365940-11365962 TCAAATGGTGCATGTTCTCAAGG - Intergenic