ID: 1062105774

View in Genome Browser
Species Human (GRCh38)
Location 9:134753993-134754015
Sequence CATGTTTTCAAGGAAATTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062105763_1062105774 27 Left 1062105763 9:134753943-134753965 CCCGTTCTCCGGCGGCAGCGACG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1062105774 9:134753993-134754015 CATGTTTTCAAGGAAATTCGTGG 0: 1
1: 0
2: 1
3: 11
4: 150
1062105766_1062105774 19 Left 1062105766 9:134753951-134753973 CCGGCGGCAGCGACGGCGAGCAT 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1062105774 9:134753993-134754015 CATGTTTTCAAGGAAATTCGTGG 0: 1
1: 0
2: 1
3: 11
4: 150
1062105764_1062105774 26 Left 1062105764 9:134753944-134753966 CCGTTCTCCGGCGGCAGCGACGG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1062105774 9:134753993-134754015 CATGTTTTCAAGGAAATTCGTGG 0: 1
1: 0
2: 1
3: 11
4: 150
1062105762_1062105774 30 Left 1062105762 9:134753940-134753962 CCTCCCGTTCTCCGGCGGCAGCG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1062105774 9:134753993-134754015 CATGTTTTCAAGGAAATTCGTGG 0: 1
1: 0
2: 1
3: 11
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062105774 Original CRISPR CATGTTTTCAAGGAAATTCG TGG Intronic
909254123 1:73396754-73396776 CATGTTTTCAAGGAGGTTACAGG + Intergenic
911303583 1:96205806-96205828 TATGTTTTCAAGGACATACTAGG - Intergenic
917613997 1:176718523-176718545 CATGTTTAAAAGGAAATTTATGG - Intronic
920860871 1:209705429-209705451 CATGTGTTCATAGAAATTCCAGG - Intronic
921545027 1:216464342-216464364 TATATTTTCAAGGAAATTACTGG - Intergenic
921898377 1:220424420-220424442 CATGTTTCCCAGGCAATTTGAGG + Intergenic
922311626 1:224398004-224398026 CATGTCTCCAAGAAAATTCAGGG - Intronic
922640516 1:227225787-227225809 TGTGTTTTCAAGGAAATCAGAGG - Intronic
1063218504 10:3944887-3944909 CATGTTTTAAGGGATATTCCTGG + Intergenic
1065218137 10:23470453-23470475 CATGTATGCAAAGAACTTCGTGG + Intergenic
1065419158 10:25522366-25522388 CCTGTTTTCAAGGAAATTGTAGG + Intronic
1067134887 10:43599152-43599174 TATGTCTTCAAGGATATTCATGG + Intergenic
1067676192 10:48379884-48379906 TGTGTCTTCAAAGAAATTCGTGG - Intronic
1067860125 10:49837900-49837922 TAGTTTTTCAAGGAAATTTGAGG - Intronic
1074234451 10:111571189-111571211 CATGGTTTCCAGAAAATTCATGG - Intergenic
1074586341 10:114770695-114770717 CCTGATTTCAAGGAGATTTGGGG - Intergenic
1078493809 11:11796132-11796154 CATGTTTGAAAGGAAATGGGAGG - Intergenic
1082879407 11:58023517-58023539 CCTGTTTTTAAGGAAATTTAAGG - Intergenic
1083123537 11:60539574-60539596 AATGTTTTCCATGAAATTAGGGG - Intronic
1085198342 11:74685564-74685586 TGTATTTTCAAGGAAATTTGGGG + Intergenic
1086374583 11:86187294-86187316 CTAGTTTTAAAGGAAATTTGGGG - Intergenic
1087403326 11:97696138-97696160 GATGTTTCCAAAGAAATTGGGGG - Intergenic
1089042424 11:115464920-115464942 CATGTTTTCAAGAAATTTCCAGG + Intronic
1091178185 11:133580027-133580049 CATGTTTTCAAGGAAGACCCTGG + Intergenic
1092044986 12:5425413-5425435 AATATTTTCAAGGAAACACGAGG + Intergenic
1094342687 12:29430571-29430593 CAGGTTTTCAGGGAAACTGGGGG + Intronic
1095907598 12:47393933-47393955 CTTGCTTTCAAGAAAATTCCAGG + Intergenic
1098134662 12:67389684-67389706 CAAATTTTCCAGGAAATTGGTGG - Intergenic
1098975415 12:76896874-76896896 CATATTTTCATGGATATTCTTGG - Intergenic
1099121376 12:78693613-78693635 CTGTTTTTCAAGGAAATTCATGG + Intergenic
1099321386 12:81154586-81154608 TATTTTTTCAAGGAATTTAGTGG - Intronic
1102392576 12:112561516-112561538 CATGTTTTCAAAGCAACTGGTGG - Intergenic
1104587632 12:130060151-130060173 AATATTTTCTAGGAAATTCTGGG + Intergenic
1105741223 13:23325044-23325066 CAAGTTTTGAAGGGAATTTGAGG + Exonic
1105880183 13:24598764-24598786 AATGTTTTCAAGGACAATCATGG - Intergenic
1105919649 13:24950102-24950124 AATGTTTTCAAGGACAATCATGG + Intergenic
1106598363 13:31166159-31166181 CATGTTGTGAAGGAAATCAGTGG - Intergenic
1106710012 13:32320649-32320671 CATGCTTTGAAAGAAATTCATGG + Intronic
1107895547 13:44958873-44958895 TATGTTTTAGAGGAAATTCAAGG + Intronic
1109349710 13:61162588-61162610 AATGTTTGCAAGGAAAATAGAGG - Intergenic
1113971776 13:114196767-114196789 CATGTTTTCAAGGACTTCCTGGG - Intergenic
1114465681 14:22920620-22920642 CATGTTCTCAGGGATATTCCAGG + Exonic
1115452910 14:33569349-33569371 GATGTTTTCAAGGCAGTTCAAGG + Intronic
1115518300 14:34207367-34207389 CTTGTTCTCAAGGAAATTCCAGG + Intronic
1115732901 14:36290781-36290803 CTTCTTTTCAAGAAAATTAGGGG - Intergenic
1116568565 14:46485175-46485197 CATGTTTTCTAGGAAAATTTAGG - Intergenic
1116733351 14:48655241-48655263 CTTGTTTACAAGGAATTCCGTGG - Intergenic
1120602440 14:86528255-86528277 CATATTTTTTAGGAAATTCATGG - Intergenic
1125144496 15:36451107-36451129 CATGTTTTTGAGGAGATCCGTGG + Intergenic
1131366216 15:91843628-91843650 AATGTTTTCAAGAAAATGCATGG + Intergenic
1133462487 16:5999459-5999481 TCTGTTTTTAAGGAAATTTGAGG - Intergenic
1143418090 17:6764975-6764997 CTGGTTTTCAAGGACATTGGTGG + Intronic
1145815329 17:27791315-27791337 CATTTTTACAAGGAAATGCTTGG - Intronic
1146110905 17:30088416-30088438 CATATTTACAAGGAAATTCATGG - Intronic
1152447135 17:80352279-80352301 CATGTTTTCATGGTAATCAGTGG - Intronic
1152596972 17:81242540-81242562 GAGGTTTGCAAGGAAATTTGGGG - Intergenic
1153621898 18:6987128-6987150 CAAGTTTACCAGGAAATTTGGGG - Intronic
1155729311 18:29132630-29132652 AGTGTTTTCAAGCAATTTCGTGG - Intergenic
1155734826 18:29208557-29208579 TATGTCTTCAAGGACATTCAGGG + Intergenic
1156948410 18:42863620-42863642 CATGCTTTCTTGGAAATTCCAGG + Intronic
1159139478 18:64375966-64375988 CATGTTTTCAAGAATATACTTGG + Intergenic
1163328520 19:16620873-16620895 ACTGTTTTAAAGAAAATTCGAGG - Intronic
1167562832 19:50236349-50236371 CCTGTTTACAAGGATATTCACGG - Intronic
925100176 2:1237689-1237711 CCTGTTACCAAGGGAATTCGGGG + Intronic
926091477 2:10053125-10053147 AACGTTTTCAAGGAAATTCTAGG + Exonic
928651811 2:33411666-33411688 CAATTTTACAAGGAAATTCTGGG - Intergenic
940578606 2:155548271-155548293 GATGTTTTGTAGAAAATTCGTGG + Intergenic
944806671 2:203288436-203288458 CATGTTATAAAGGAAGTTCAGGG - Intronic
946196865 2:218038187-218038209 TATGTGTTCAAGGAGATTCATGG - Intronic
947027838 2:225758891-225758913 CATATGTTCAGGGAAAATCGTGG + Intergenic
947174347 2:227348044-227348066 AATGTTTTAAAGGAAATTCAGGG + Intronic
948318620 2:237050970-237050992 TGTGTTTTCAGGGAAATTAGTGG + Intergenic
1169248475 20:4042356-4042378 CATTTTTTCAGGGAAATCTGTGG - Intergenic
1169290406 20:4344934-4344956 CATGTTTTCAAGGATGTACACGG + Intergenic
1173491062 20:43482208-43482230 CATGTCTTCAAGGAGATTCATGG - Intergenic
1174491656 20:50902329-50902351 CAGGTTTCCAAGGAAATTGCTGG + Intronic
1176421080 21:6516071-6516093 CTTTTCTTCAAGGAAATTCATGG + Intergenic
1179696571 21:43124389-43124411 CTTTTCTTCAAGGAAATTCATGG + Intergenic
1184513056 22:44944250-44944272 CGTCCTTTCAAGGGAATTCGGGG + Intronic
950564078 3:13754745-13754767 CATGTTTTCAAGGTTCTTCCTGG + Intergenic
952055173 3:29435403-29435425 GATGTTTTCAAAGAAACTAGAGG - Intronic
952542538 3:34381558-34381580 CATGGTTTCCAGGAACTTCCAGG + Intergenic
955772162 3:62396052-62396074 CATATGTACAAGGAAATTCATGG + Intergenic
956101845 3:65776720-65776742 CATGTTTTACATTAAATTCGTGG - Intronic
957343483 3:78931046-78931068 CTTGTCTTCATGGAAATTCCAGG - Intronic
957649974 3:82988220-82988242 AATGTTTTCTATGAAATTAGAGG - Intergenic
959822158 3:110748965-110748987 CATTTTTTCAAAGAAATTATTGG + Intergenic
960225738 3:115166053-115166075 CATGTTTGCAAGGAAAAGAGAGG + Intergenic
960603759 3:119483897-119483919 AATGATTGCAAGGAAATTCTCGG + Intronic
962090026 3:132233442-132233464 CATGATTTCAAGGATATTTTTGG - Intronic
964242534 3:154613793-154613815 TACATTTTCAAGGAAATTAGTGG - Intergenic
967460613 3:189741906-189741928 TCTGTTTTCAAGGAACTTCTAGG + Intronic
967591379 3:191278619-191278641 GATGCTTTGAAGGAAATTCCCGG - Intronic
968106972 3:196008221-196008243 CCTGTTTTCAAGGAACTTACAGG - Intergenic
969148782 4:5149819-5149841 CATATTTTTAAGGAAAATCTAGG + Intronic
971569787 4:28196635-28196657 CCTGTTTTCTAGGATATTGGTGG - Intergenic
972141438 4:35964936-35964958 AATATTTTCAAGGTAATTCACGG + Intronic
972325840 4:38014592-38014614 CACGTTTTCCAAGAAGTTCGAGG + Exonic
972926833 4:44019671-44019693 CATGTTTTCAATTAAATGTGAGG + Intergenic
973298122 4:48549750-48549772 CATGTTTGCTAGGAAAATCTAGG + Intronic
975423276 4:74195124-74195146 CATGTTTTCAAGGAACATCAAGG + Intronic
976845367 4:89483237-89483259 CAAGTGATCAAGGAAATTCAAGG + Intergenic
978557401 4:109995629-109995651 CATATTTTCAAGGCAATAGGAGG + Intronic
981122805 4:141071945-141071967 CATATTTTCAAGCAATTTCTAGG + Intronic
982539278 4:156647384-156647406 CATTTTTTAATGGAAATTCCAGG - Intergenic
987219712 5:15778119-15778141 CATGGTATAAAGTAAATTCGTGG + Intronic
988941271 5:36150884-36150906 CATTTTTTCAAGGAAACCAGAGG + Intronic
990694518 5:58401118-58401140 CATGTTTTCAAAGGAAATTGTGG - Intergenic
991032048 5:62092484-62092506 CATGTTTTTTAGGGAATTTGGGG + Intergenic
991680552 5:69135272-69135294 CCTGTTCTTAAGGAAAATCGAGG - Intergenic
992590965 5:78295214-78295236 CATCTTTTCAATGAAAGTCTTGG + Intergenic
993098505 5:83507920-83507942 CATGTTTTTAATGAGATACGGGG + Intronic
993939873 5:94045720-94045742 CATGTTTTTAAGCAATTTTGGGG - Intronic
994325285 5:98439551-98439573 AATGTCTTCAAGGAAATGAGAGG - Intergenic
995870029 5:116734760-116734782 CAGGTTTTCCAGCAAATTCCTGG + Intergenic
1000074621 5:157773362-157773384 GATGTTTGCAAGGATATTCAAGG - Intergenic
1002050095 5:176565687-176565709 CATGTTGGCTAGGAACTTCGGGG - Exonic
1009415700 6:63414323-63414345 CAGGTTCTCAAGGAAATGGGGGG - Intergenic
1009967905 6:70596354-70596376 CATGTTTCTAAGAAAATTCTGGG - Intergenic
1010368607 6:75081349-75081371 CATTTTTTTAAGGGAATTCAAGG + Intergenic
1011405877 6:87015089-87015111 CATGTTTTCCAGGAAAAGTGTGG + Intronic
1013825348 6:114204358-114204380 CATCTTTTAAAGGAAAATCAAGG + Intronic
1016330781 6:142949845-142949867 CATGGTTTGAAGGAAATACCTGG + Intergenic
1016347255 6:143127372-143127394 CATGTTTTCAAGTTAATTTTAGG - Intronic
1016725554 6:147361627-147361649 CATGTTTCCTAGTAGATTCGTGG - Intronic
1018969446 6:168516245-168516267 CATATTTTCATAGAAATTTGTGG + Intronic
1021114908 7:16736640-16736662 CAAGTTTTCAAGGTAGTTCTGGG - Intergenic
1021829222 7:24586905-24586927 GAGGTTTTCAAGGAATTCCGAGG + Intronic
1022750314 7:33218363-33218385 CATATTTTCAGGGAAATCCAAGG - Intronic
1022972494 7:35530541-35530563 CATTGTTTCAGGGAGATTCGTGG - Intergenic
1030060965 7:105620973-105620995 CATTTTCTCAAGGAACTTGGTGG + Intronic
1031236347 7:119183507-119183529 TATGTTTTCTAGGAAATTATTGG + Intergenic
1031880664 7:127194854-127194876 CATGTTTTCCAGGGACTTCCAGG + Intronic
1032261326 7:130339551-130339573 CATATTTTAAAGGAAATATGGGG - Intergenic
1032872098 7:135997167-135997189 TATGTTTTCTAGTAAATTTGGGG + Intergenic
1033419988 7:141197061-141197083 CATATCTTAAAGGACATTCGTGG + Intronic
1033812817 7:145036736-145036758 CATGTTTTGAAGGAAATTCAAGG - Intergenic
1036398915 8:8391058-8391080 GATGTTATCACGGAAATTCCAGG + Intergenic
1037030725 8:14101574-14101596 CAAGATTTAAAGGAAATTCTTGG + Intronic
1037463097 8:19132927-19132949 CATGATTTCAAGGAATTTAGGGG - Intergenic
1041763897 8:61396829-61396851 AATGTTTTCAAGGTGATTCCAGG + Intronic
1043359301 8:79452143-79452165 CATGTTTCCAAGGAAATAGTTGG - Intergenic
1044229902 8:89761924-89761946 AATGATTTCAAGGAAATTAAAGG - Intronic
1044237199 8:89844456-89844478 CATGTCTTCAGGGAGATTCTAGG + Intergenic
1046184982 8:110701493-110701515 TAAGTTTTTAAGGAAATTTGTGG - Intergenic
1049906119 9:217954-217976 CTTGCTTTAAAGGAAATTCTTGG - Intronic
1050288911 9:4133034-4133056 AATGTTTTCAAGGAAAAGTGTGG - Intronic
1051577745 9:18636520-18636542 CATGTTTTAAAGAAAATTCAGGG + Intronic
1051859203 9:21605421-21605443 CATGTTTTAAAAGAACTTTGTGG - Intergenic
1052706919 9:32005358-32005380 CATTTGTTCAATGAAATTCTAGG - Intergenic
1053557004 9:39147661-39147683 CATGTTTACAAGTAACTTTGGGG + Intronic
1053821113 9:41967936-41967958 CATGTTTACAAGTAACTTTGGGG + Intronic
1054089987 9:60836083-60836105 CATGTTTACAAGTAACTTTGGGG + Intergenic
1054111398 9:61111641-61111663 CATGTTTACAAGTAACTTTGGGG + Intergenic
1054609459 9:67219484-67219506 CATGTTTACAAGTAACTTTGGGG - Intergenic
1054800244 9:69340426-69340448 CAAGTTTTCACGGAAATTCAGGG + Intronic
1055072461 9:72180818-72180840 CAAGTTTTCAAGTATATTCAAGG + Intronic
1056700455 9:88901581-88901603 AATGTTTCGAAGGAAATTCATGG - Intergenic
1059151643 9:111954590-111954612 CATGGTTTCAGGGAGATTCAAGG + Intergenic
1059928043 9:119231581-119231603 GATGTTTTCAATGGAATTCTGGG - Intronic
1061603696 9:131691610-131691632 TGTGTTTTCAAGGAGATTCATGG + Intronic
1062105774 9:134753993-134754015 CATGTTTTCAAGGAAATTCGTGG + Intronic
1191885179 X:65880924-65880946 CAGGGTTTGAAGGAAATTCTGGG - Intergenic