ID: 1062106218

View in Genome Browser
Species Human (GRCh38)
Location 9:134756471-134756493
Sequence TGGCGTCTTCTCGAAGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062106206_1062106218 25 Left 1062106206 9:134756423-134756445 CCCCTAGACTGACGCAGCTCCTC 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1062106218 9:134756471-134756493 TGGCGTCTTCTCGAAGCCCAGGG No data
1062106208_1062106218 23 Left 1062106208 9:134756425-134756447 CCTAGACTGACGCAGCTCCTCCA 0: 1
1: 0
2: 1
3: 10
4: 153
Right 1062106218 9:134756471-134756493 TGGCGTCTTCTCGAAGCCCAGGG No data
1062106213_1062106218 -1 Left 1062106213 9:134756449-134756471 CCGGGTCTCCTCTGCCACATTGT 0: 1
1: 0
2: 2
3: 22
4: 229
Right 1062106218 9:134756471-134756493 TGGCGTCTTCTCGAAGCCCAGGG No data
1062106207_1062106218 24 Left 1062106207 9:134756424-134756446 CCCTAGACTGACGCAGCTCCTCC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1062106218 9:134756471-134756493 TGGCGTCTTCTCGAAGCCCAGGG No data
1062106212_1062106218 3 Left 1062106212 9:134756445-134756467 CCAGCCGGGTCTCCTCTGCCACA 0: 1
1: 0
2: 1
3: 21
4: 219
Right 1062106218 9:134756471-134756493 TGGCGTCTTCTCGAAGCCCAGGG No data
1062106211_1062106218 6 Left 1062106211 9:134756442-134756464 CCTCCAGCCGGGTCTCCTCTGCC 0: 1
1: 0
2: 0
3: 48
4: 403
Right 1062106218 9:134756471-134756493 TGGCGTCTTCTCGAAGCCCAGGG No data
1062106215_1062106218 -9 Left 1062106215 9:134756457-134756479 CCTCTGCCACATTGTGGCGTCTT 0: 1
1: 0
2: 0
3: 14
4: 182
Right 1062106218 9:134756471-134756493 TGGCGTCTTCTCGAAGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062106218 Original CRISPR TGGCGTCTTCTCGAAGCCCA GGG Intronic
No off target data available for this crispr