ID: 1062107311

View in Genome Browser
Species Human (GRCh38)
Location 9:134762776-134762798
Sequence GCTGAGGCCCACACAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 8, 3: 70, 4: 467}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062107311_1062107316 9 Left 1062107311 9:134762776-134762798 CCTGCTCCTGTGTGGGCCTCAGC 0: 1
1: 0
2: 8
3: 70
4: 467
Right 1062107316 9:134762808-134762830 TGTAAGATGAGGAAGGAGAGAGG No data
1062107311_1062107317 10 Left 1062107311 9:134762776-134762798 CCTGCTCCTGTGTGGGCCTCAGC 0: 1
1: 0
2: 8
3: 70
4: 467
Right 1062107317 9:134762809-134762831 GTAAGATGAGGAAGGAGAGAGGG No data
1062107311_1062107315 2 Left 1062107311 9:134762776-134762798 CCTGCTCCTGTGTGGGCCTCAGC 0: 1
1: 0
2: 8
3: 70
4: 467
Right 1062107315 9:134762801-134762823 AGTCTGCTGTAAGATGAGGAAGG No data
1062107311_1062107314 -2 Left 1062107311 9:134762776-134762798 CCTGCTCCTGTGTGGGCCTCAGC 0: 1
1: 0
2: 8
3: 70
4: 467
Right 1062107314 9:134762797-134762819 GCACAGTCTGCTGTAAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062107311 Original CRISPR GCTGAGGCCCACACAGGAGC AGG (reversed) Intronic
900089903 1:915600-915622 GGTGAGGCCCTCACAGCATCTGG - Intergenic
900315327 1:2053456-2053478 GCTGAGGCCAACAGAGACGCAGG + Intronic
900416924 1:2539643-2539665 GCTGAGGCTCAGAGAGGAGTGGG - Intergenic
900525364 1:3125853-3125875 GCTGGGGCCCACAAAGGAGCCGG - Intronic
900587905 1:3442273-3442295 GCTGAGGTCCACCCAAGAACCGG + Intergenic
901082122 1:6589367-6589389 GCTGAGGCCCACATAGGACCGGG - Intergenic
901577071 1:10210151-10210173 CCTGACGCCCGCAGAGGAGCTGG - Intergenic
901715507 1:11150306-11150328 GGTGAGGACTACACAGGAACTGG + Intronic
902272994 1:15318044-15318066 ACTGAGGCTCACACAGGGACAGG + Intronic
902374535 1:16024087-16024109 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
902379476 1:16045851-16045873 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
902398539 1:16145181-16145203 GCTGAGGCCAGCACAGGAAGCGG + Intronic
902518995 1:17005237-17005259 GCTGAGGTCCAGAGAAGAGCGGG + Intronic
902706987 1:18212520-18212542 ACTGAGGCCCAGAGAGGAGTAGG + Intronic
902957657 1:19936817-19936839 ACTGAGGCCTAGAGAGGAGCAGG + Intergenic
903014731 1:20354461-20354483 ACTGAGGCCCAGACGGGGGCAGG - Intronic
903183598 1:21617611-21617633 CCTGGGGCCCACACAGGCTCTGG - Intronic
903221602 1:21872656-21872678 GGTGATGCCCATACAGAAGCAGG + Exonic
903420489 1:23215491-23215513 TCTAAGGCCCACAGAGGGGCAGG - Intergenic
903620426 1:24694109-24694131 ACTGTGGCCCAGAGAGGAGCAGG - Intergenic
903847854 1:26289173-26289195 GCTGAGGCCCATAGAGGCCCAGG - Intronic
903889561 1:26560552-26560574 ACTGAGGCCCAGAGAGGGGCAGG + Intronic
903975332 1:27146113-27146135 AATGAGGCCCACACAGGCGATGG + Intronic
904615612 1:31747979-31748001 CAGGAAGCCCACACAGGAGCTGG - Intronic
904755210 1:32765220-32765242 GCAGAGGCCCCCAGAGGGGCAGG - Intronic
904851541 1:33463245-33463267 ACTGAGGCCCAGACAGAAGAAGG - Intergenic
905318073 1:37096245-37096267 GCAGAGGCCAAGACAGCAGCAGG + Intergenic
905731460 1:40301771-40301793 GCTGAGGAACACACTGCAGCTGG + Intronic
905886000 1:41492311-41492333 GCTGATGCTCAGACAGGAGAAGG - Intergenic
907243899 1:53095059-53095081 GCACAGGCACACACAGAAGCAGG + Intronic
907454104 1:54564357-54564379 GCTGTGGCCCAGAGAGGACCAGG + Intronic
907930334 1:58993209-58993231 GCTGAGCCACCCAAAGGAGCAGG - Intergenic
908008169 1:59748230-59748252 GGTGAGGACCACAGAGAAGCAGG + Intronic
910086620 1:83410848-83410870 GATGGGGCCCTGACAGGAGCAGG + Intergenic
912798327 1:112706098-112706120 ACTGAGCCCCACACAGGGCCTGG + Exonic
912946794 1:114091861-114091883 GCTTTGACCTACACAGGAGCAGG + Exonic
913256226 1:116956538-116956560 GCTGAGGCAGACAGAGCAGCAGG + Intronic
913568146 1:120093894-120093916 GCTGAGCCCCTCACTGGAGGTGG - Intergenic
913675991 1:121140952-121140974 GCTTAGGCCTACACAGGGTCAGG + Intergenic
914027886 1:143928895-143928917 GCTTAGGCCTACACAGGGTCAGG + Intergenic
914288955 1:146254918-146254940 GCTGAGCCCCTCACTGGAGGTGG - Intergenic
914549990 1:148705661-148705683 GCTGAGCCCCTCACTGGAGGTGG - Intergenic
914939142 1:152006833-152006855 GCTGAGGCCCCCCCTGCAGCGGG + Intergenic
915571346 1:156746926-156746948 GCTGAGACACACCCAGGAGAAGG + Intronic
916524628 1:165598124-165598146 GCTGAGCCCCACGCAGGTCCCGG - Intergenic
916695564 1:167232345-167232367 GCCTAGGCCCACACAGGGTCAGG - Intronic
917678348 1:177341098-177341120 GGTGATGCCCACACCAGAGCTGG - Intergenic
918003427 1:180519902-180519924 GCTCAGGAGCTCACAGGAGCAGG + Intergenic
919834702 1:201565760-201565782 ACTGAGGCCCACACAGTTGAAGG + Intergenic
920153348 1:203927650-203927672 GCCTAGGCCTACACAGGATCGGG + Intergenic
920354001 1:205356829-205356851 GCTGAGGCCCTCTCAGTAGGGGG - Intronic
920463361 1:206159790-206159812 GCTTAGGCCTACACAGGGTCAGG + Intergenic
922012536 1:221605464-221605486 GCTTAGGCCTACACAGGGACAGG + Intergenic
922322913 1:224503586-224503608 GCTCAGGCCTGCACAGGGGCGGG + Intronic
922749501 1:228063949-228063971 GCTGGGGCCCAGAGAGGAGATGG + Intergenic
922749577 1:228064267-228064289 ACTGAGGCCCAGGCAGGAGTGGG - Intergenic
924159221 1:241212862-241212884 GCTGTGGCCCACACAGCAGTGGG - Intronic
924291502 1:242541499-242541521 GCTGAGGATCACACATGAGTAGG - Intergenic
924631187 1:245742459-245742481 GCTGAGGCCTGCTCAGGGGCTGG + Intergenic
1063386496 10:5619557-5619579 GCTGCCGACCACACAGGGGCAGG - Intergenic
1064397490 10:14993308-14993330 GGTGAGGCAAAAACAGGAGCCGG - Intergenic
1065352046 10:24804340-24804362 GCTGGGACCCACACAGGAGCGGG + Intergenic
1066341995 10:34543927-34543949 GATGAGTGCCAGACAGGAGCAGG - Intronic
1067557472 10:47282823-47282845 GCTGAGGCACACATAGGTGGAGG + Intergenic
1067569395 10:47360432-47360454 GCACAGGCCTACACAGGAGAGGG + Intergenic
1069705406 10:70456395-70456417 GGTGTGGCCAAGACAGGAGCTGG - Intergenic
1069948040 10:72000882-72000904 GCTGAGGCCCACACCCCTGCTGG - Intronic
1070138656 10:73719272-73719294 GGTGGGGCCCACCCATGAGCTGG - Intergenic
1071520724 10:86330156-86330178 GCTGAGGCCCTCCCCGGGGCTGG - Intronic
1072439123 10:95438439-95438461 CCTGTGGGCCACACATGAGCAGG + Intronic
1072780512 10:98248136-98248158 GCAGAGGCCCTGACAGGGGCTGG + Exonic
1073074843 10:100817433-100817455 GCTCAGGGCCTCACAGGAGGTGG - Intronic
1073381127 10:103078852-103078874 GCTGAGGAGCAGACAGCAGCGGG + Exonic
1073435514 10:103513616-103513638 ACTGAGGCTCACAGAGGAGCAGG + Intronic
1073906709 10:108289703-108289725 GCCAAGGCCTACACAGGAACAGG + Intergenic
1074221773 10:111444984-111445006 ACTGAGGCCCACAGAAGAGAAGG + Intergenic
1074859280 10:117498004-117498026 GCTGAGGCCCAGAGAGGGGAAGG + Intergenic
1075015926 10:118909990-118910012 GCAGAGGCAGAGACAGGAGCTGG + Intergenic
1075463027 10:122631362-122631384 TCTGTGGCCCAGGCAGGAGCTGG + Intronic
1075770044 10:124926455-124926477 GCTTAGGCCTACACAGGGCCAGG + Intergenic
1076818327 10:132925481-132925503 GCTGAGGACCTCAGAGGGGCCGG - Intronic
1077486938 11:2843277-2843299 GCCCAGCTCCACACAGGAGCCGG + Intronic
1077564722 11:3290298-3290320 CCTGAGGGCCGCACAGGTGCGGG + Intergenic
1078367904 11:10721864-10721886 CCAGATGGCCACACAGGAGCTGG + Intergenic
1079118896 11:17663273-17663295 GCCTAGGCCTACACAGGGGCAGG + Intergenic
1080788867 11:35501627-35501649 GCCTAGGCCTACACAGGATCAGG + Intronic
1080882213 11:36332829-36332851 GCTGAGGCCTCATCAGGAGCAGG + Intronic
1081661810 11:44893035-44893057 GCTGAGGCCCAGAGAGGGACGGG - Intronic
1081813789 11:45927674-45927696 ACTGAGGCCCAGAAAGGAGCAGG - Intronic
1082997277 11:59264032-59264054 ACTGAGGCCCACACAGATGAAGG - Intergenic
1083328153 11:61884101-61884123 GGAGAGGCCCACAGAGGACCAGG - Intronic
1084013812 11:66367282-66367304 ACTGAGGCCCAAACAACAGCAGG + Intronic
1084399875 11:68937300-68937322 GCCGAGTCCCACACAGGGTCTGG - Intronic
1084728249 11:71056108-71056130 CCTGAGGATCACACAGGAGGGGG - Intronic
1084887290 11:72219079-72219101 ACATGGGCCCACACAGGAGCTGG + Intronic
1084942495 11:72620438-72620460 ACTGAGGCCCAGAGAGTAGCAGG + Intronic
1084979432 11:72821526-72821548 GCTGAGCCCCACACAGGTTTGGG - Intronic
1084980115 11:72824517-72824539 ACAGAGGCAGACACAGGAGCAGG - Intronic
1085258199 11:75189046-75189068 ACGGAGGCCCAGAAAGGAGCAGG - Intronic
1085261397 11:75207314-75207336 GCTGAGGCCCTCCCTGGATCTGG + Intergenic
1085619930 11:78030418-78030440 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
1085958678 11:81433227-81433249 GCTGAGGCCTACCCAGGGTCAGG + Intergenic
1086041545 11:82485612-82485634 ACTGAGGCCCAGAGAGGAGCAGG - Intergenic
1087224668 11:95584828-95584850 GCATAGGCCCACACAGGATCAGG - Intergenic
1087827527 11:102782852-102782874 GCCCAGGCCTACACAGGATCAGG - Intergenic
1087873368 11:103326501-103326523 TCTGCGGCCAACACTGGAGCTGG - Intronic
1088168563 11:106967897-106967919 TCTGAATCCCACACAGGAACTGG - Intronic
1088266154 11:107989803-107989825 GCCTAGGCCTACACAGGATCAGG + Intergenic
1088327262 11:108613683-108613705 CCTGGGGGCCACACAGCAGCAGG + Intergenic
1088813454 11:113406568-113406590 GCAGAGGCCCAGAGAGGCGCAGG - Intergenic
1089015427 11:115161464-115161486 GCTGAGACCTACAGAGGAGCAGG + Intergenic
1089664702 11:120010865-120010887 TCTGAGGGCCCCACACGAGCCGG + Intergenic
1090426040 11:126607705-126607727 GCAGAAGGCCACACAGCAGCAGG - Intronic
1091402007 12:186849-186871 TGTGAGGTCCACACCGGAGCAGG + Intergenic
1092098009 12:5860191-5860213 GCTGAGACCCAAATAGGAGTTGG - Intronic
1092432659 12:8421535-8421557 GGTGAGGCAAAAACAGGAGCCGG - Intergenic
1092435254 12:8442173-8442195 GGTGAGGCAAAAACAGGAGCCGG - Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1092996675 12:13957646-13957668 GAAGAGACCCACCCAGGAGCTGG + Intronic
1095976395 12:47943306-47943328 GCTGGGCCCCACACAGCAGGAGG + Intergenic
1096802542 12:54120686-54120708 GCTGAGGGACACACAGGAGGGGG - Intergenic
1097003231 12:55896201-55896223 GCTTAGGCCTACACAGGATCAGG + Intergenic
1098870898 12:75815833-75815855 ACTGAGGCCCAGAAAGGAGAAGG + Intergenic
1098880465 12:75912066-75912088 GCCTAGGCCCACACAGGGTCAGG - Intergenic
1099322182 12:81163703-81163725 GCCTAGGCCTACACAGGATCAGG - Intronic
1099977411 12:89560381-89560403 GCTGAGGGTCACACCAGAGCAGG + Intergenic
1101682581 12:106984125-106984147 GCTGAGCTCAGCACAGGAGCAGG - Intronic
1103876395 12:124130836-124130858 GCTGAGCCCCACACTGGAAGCGG - Intronic
1103918246 12:124386809-124386831 GCTGCGGCACACACAGGCACAGG + Intronic
1103976029 12:124703324-124703346 GATGCTGCCCACATAGGAGCAGG + Intergenic
1104004129 12:124880257-124880279 GCTGGAGCCCACAGAGAAGCTGG + Intronic
1104611616 12:130233714-130233736 GCTAAAGCCCACACAGCAGGAGG + Intergenic
1105827730 13:24137304-24137326 GCAAAGGCCCAGCCAGGAGCAGG - Intronic
1106919077 13:34543346-34543368 GCTTAGGCCTACACAGGGTCAGG - Intergenic
1108171265 13:47744559-47744581 GCAGGGGCCCTCACAGGAGAAGG + Intergenic
1108233678 13:48378410-48378432 GCCTAGGCCTACACAGGATCAGG + Intronic
1108541841 13:51452837-51452859 GCTGGGACACACACAGGGGCCGG - Exonic
1112328954 13:98462441-98462463 TCTGAGGCCCATACAGGACAGGG - Intronic
1113456218 13:110450622-110450644 TCTGGGGTCCACGCAGGAGCTGG + Intronic
1117123077 14:52590151-52590173 GCTTAGGCCTACACAGGGTCAGG - Intronic
1118918178 14:70125784-70125806 GATGAGGCCCAGACATGAGTGGG - Intronic
1119231286 14:72981794-72981816 GCTGAGGCACAAGGAGGAGCAGG + Exonic
1119678223 14:76572353-76572375 GCTGTGCCCCACACAGGGGAGGG - Intergenic
1121322393 14:92999577-92999599 GCTGAGGCCCAGCAAGGAGGAGG - Intronic
1121448421 14:93992866-93992888 GCTGAGGGCCTCAGAGGAGGTGG + Intergenic
1121994174 14:98589057-98589079 CCTGAGGCCCCCTCAGAAGCCGG + Intergenic
1122270741 14:100567612-100567634 GCTGAGGACCGCACAGGACCAGG + Intronic
1122536095 14:102464089-102464111 GCTGAGGGCCACACGGCAGGAGG - Intronic
1122792860 14:104191686-104191708 GGTGAGCCCCACCCAGGAACGGG - Intergenic
1122941629 14:104984113-104984135 GCTGAGGCCCAGACGGGGGTGGG + Intergenic
1124225276 15:27888040-27888062 TCTGAGGCCCCCACAGGAAGGGG + Intronic
1124665888 15:31592408-31592430 GCCTAGGCCCACACAGGGTCAGG + Intronic
1124848055 15:33310894-33310916 GCTGAGGCTGAGCCAGGAGCTGG + Intergenic
1125587017 15:40828309-40828331 ACTGAGACCTTCACAGGAGCTGG - Intronic
1126574503 15:50183749-50183771 GAAGAGGCCTACACAGGAGTGGG + Intronic
1126666032 15:51077246-51077268 ACTGAGGCCAACACAGGAAGAGG - Intronic
1128526120 15:68413612-68413634 GCTGAGGCCCAGAGAGGCACCGG - Intronic
1128562377 15:68677390-68677412 GCTGAAGGCCACACAGCAGAGGG + Intronic
1128649267 15:69398591-69398613 GCTGAGCTCCACCCAGCAGCTGG + Intronic
1128776376 15:70323478-70323500 GCTGGGGCCTCCCCAGGAGCTGG - Intergenic
1128992547 15:72272722-72272744 GCTGAGGCGCGCCCAGGAGCAGG - Intronic
1129160037 15:73742200-73742222 GCTGAGGCCTCCAGAAGAGCTGG + Intronic
1129165139 15:73772794-73772816 ACTGAGGCCCAGAGAGGAGCGGG + Intergenic
1129188556 15:73924820-73924842 GCTGAGGCCAACACTGCAGGGGG + Intergenic
1129268549 15:74407765-74407787 GCTGAGGCCCAGAGAGGACAGGG + Intergenic
1129275674 15:74443639-74443661 GCTGTGGCGCTCACAGGAGAGGG - Intergenic
1129717294 15:77859842-77859864 GCAGAGGCCCAGACAGGACCAGG + Intergenic
1129764573 15:78153921-78153943 GCTGAGGCAAACCCAGGAGGTGG + Intronic
1130461741 15:84164457-84164479 GCAGAGGCCCAGACAGGACCAGG - Intergenic
1130559562 15:84947343-84947365 GCTGAGGCCAACATATGGGCAGG - Intergenic
1130566939 15:85004236-85004258 GCTGGGGCCCACCCTAGAGCTGG - Intronic
1130649278 15:85752789-85752811 CCTGAGGCCCACTCAGCACCTGG - Intergenic
1130653039 15:85773084-85773106 GCTGAGGCCCACACAGCTTCTGG + Intronic
1131721607 15:95174611-95174633 GCTGAGGCCCAGTCAGGTGTAGG - Intergenic
1131908389 15:97169207-97169229 GCTGAGGCCCAGAGAGGAGATGG + Intergenic
1132149081 15:99447133-99447155 GCTGAGAGCCACTCAGCAGCTGG + Intergenic
1132624226 16:882649-882671 GCAGAGGCCATCACAGGACCAGG + Intronic
1132990582 16:2790770-2790792 GCTGAGGGACACAGAGGAGGGGG + Intergenic
1133055714 16:3144550-3144572 GCTGAGGCAGCCACAGCAGCTGG + Exonic
1133569188 16:7024927-7024949 ACTGAGGCCCAGAGAGGAACAGG + Intronic
1133739149 16:8638759-8638781 GTTTATGGCCACACAGGAGCTGG - Intronic
1133982896 16:10646799-10646821 GCTGTGGCTCACAGAGGACCAGG - Intronic
1136008156 16:27345163-27345185 ACTGAGGCCCAGGCAGGGGCAGG - Intronic
1136544827 16:30949066-30949088 GCGGAGGCCAAAACAGGAACTGG - Exonic
1137384668 16:48030326-48030348 GCTGAGGCCCAGAGAGGTGAAGG - Intergenic
1138512416 16:57516271-57516293 GGTGAGGACCACAGAGGGGCAGG - Exonic
1138656438 16:58494330-58494352 GCTGAGGCCCACACAGTGAGGGG - Intronic
1140457350 16:75113049-75113071 GCTGAGGCCTAGAGAAGAGCAGG - Intronic
1140477218 16:75245083-75245105 CCAGAGCCCCACAGAGGAGCGGG + Intronic
1142033540 16:87850279-87850301 GCAGGGCCCCACACAGGAGGAGG + Intronic
1142304089 16:89275877-89275899 AACAAGGCCCACACAGGAGCGGG + Intronic
1142811241 17:2396603-2396625 GGCAAGGCCCACTCAGGAGCTGG + Intronic
1143029921 17:3962218-3962240 ACTGAGGCCCAGAGAGGAGCAGG + Intronic
1143108359 17:4540588-4540610 GCTGAGGCCCAGGAAGGGGCAGG - Intronic
1143400164 17:6638356-6638378 CCAGACGCCCACACAGCAGCAGG + Intronic
1143405650 17:6675569-6675591 GCTGAGGCACAGCCAGGAGCAGG - Intergenic
1143631066 17:8140646-8140668 CCTGAGGCCCAAGCAGGACCCGG - Exonic
1144625041 17:16840188-16840210 CCTGAGACTCACACAGGAGTCGG + Intergenic
1144674918 17:17155853-17155875 GCTGAGGCCACCACAGGATGTGG - Intronic
1144734545 17:17547689-17547711 GCTGTGCCCCAGACAGGAGGAGG - Intronic
1144881389 17:18432533-18432555 CCTGAGACTCACACAGGAGTCGG - Intergenic
1145150844 17:20511853-20511875 CCTGAGACTCACACAGGAGTCGG + Intergenic
1146053360 17:29568840-29568862 GCCGAGGCCTTCCCAGGAGCGGG - Intronic
1146786859 17:35728681-35728703 GCTGAGGCCCAGACACGAAGTGG - Intronic
1146896247 17:36544503-36544525 GCAGAGGCCCAGAGAGGACCTGG - Intergenic
1146945260 17:36869253-36869275 GCTGGGGCTTACACAGGTGCTGG + Intergenic
1147349721 17:39831604-39831626 TCTTGGGCCCACACAGAAGCAGG - Intronic
1147364983 17:39953366-39953388 GCTGAGGACCAGACATGCGCCGG + Intergenic
1148188826 17:45664780-45664802 CCACAGGCCCAGACAGGAGCTGG + Intergenic
1148438747 17:47701022-47701044 ACTGAGGCCCAGAGAGGGGCAGG + Intronic
1149170010 17:53798190-53798212 GCCTAGGCCCACACAGGGCCAGG - Intergenic
1150415963 17:64988944-64988966 GCCGAGTGCCACCCAGGAGCTGG - Intergenic
1150795746 17:68235432-68235454 GCTGAGGGCCACCCAGGAGCTGG + Intergenic
1150867839 17:68872728-68872750 GCTGAGGCCTACACAGAGTCAGG - Intronic
1151332662 17:73420075-73420097 GCTGAGCCCCAGGCAGGAGCAGG + Intronic
1152012482 17:77727008-77727030 GCTGATTCCCACCCAGAAGCAGG + Intergenic
1152073414 17:78145173-78145195 GCAGTGGCCCACAGCGGAGCTGG + Intergenic
1152687964 17:81703806-81703828 GCTGAGGCCAAGGGAGGAGCAGG - Intronic
1152768248 17:82152409-82152431 GAGGAGGCCGACACAGGGGCAGG + Intronic
1152920448 17:83064013-83064035 GCTGAGCCCCAGCCAGGTGCCGG - Intergenic
1153627955 18:7039769-7039791 GATGAGGCCCACAGAGGAGGTGG + Intronic
1154079687 18:11243709-11243731 GCTGAGGCCTGCACTGGAGAGGG + Intergenic
1157833601 18:50879158-50879180 GCTCAGGCTCACACTGGCGCGGG - Exonic
1158829174 18:61259151-61259173 GGAGAGGCCCACTCAGGACCAGG + Intergenic
1158983977 18:62794778-62794800 GATGAAGCACACACAGGAACTGG + Intronic
1160077807 18:75694488-75694510 GGTGTGGCCCACAGAGCAGCGGG - Intergenic
1160104923 18:75964962-75964984 GTTGAGGCCCACCCAGGTGGAGG + Intergenic
1160798579 19:956797-956819 ACTGAGGCCCAGAGAGGGGCAGG + Intronic
1160860156 19:1234290-1234312 GCTGGGGCCCACAGAGCGGCCGG + Exonic
1161060730 19:2213550-2213572 GCTGAGCCGCACCCAGGAGCTGG - Exonic
1161232278 19:3180240-3180262 ACTGAGGCCCAGAGAGGGGCCGG - Exonic
1161377459 19:3947295-3947317 GGGGGGTCCCACACAGGAGCAGG - Intergenic
1161702112 19:5801360-5801382 ACTGAGGCTCAGAGAGGAGCAGG - Intergenic
1161713835 19:5864526-5864548 ACTGAGGCCCACAGAGGGCCAGG - Intergenic
1161793591 19:6374518-6374540 GCTGGTGCACACCCAGGAGCCGG + Exonic
1161993407 19:7698275-7698297 ACTGAGGCCCAGAGAGGAGCGGG + Intronic
1162018415 19:7857798-7857820 GCTGAGGCCCCGGCAGGAGAGGG - Intronic
1162199465 19:9010232-9010254 GCTGGGGCTCACTGAGGAGCTGG - Intergenic
1162562655 19:11426499-11426521 GGTGAGGACCAAACATGAGCTGG - Exonic
1163271916 19:16259630-16259652 GTTGAGGCCCAGAGAGGGGCAGG + Intergenic
1163410751 19:17152821-17152843 GTGGAGGCTCTCACAGGAGCAGG + Intronic
1163654394 19:18537452-18537474 ACTGAGGCCCAGACGGGTGCAGG - Intronic
1164618361 19:29679859-29679881 ACTGAGGCCCACCCATGCGCTGG + Intergenic
1165149348 19:33751806-33751828 GCTGAAGCCCCCACGGGAGCGGG + Intronic
1165170200 19:33887072-33887094 GCTTAGGCACACACAGGTGCTGG + Intergenic
1165495730 19:36151229-36151251 GCTGAGGCCCAGGGAGGAGTCGG - Intronic
1166334170 19:42095513-42095535 GGTGAGGGCCACCCAGGAGAGGG + Intronic
1167593685 19:50416996-50417018 GCTGGGGCCCAGCCAGGAACTGG - Intronic
1167732343 19:51267686-51267708 GCTAAGGCCCAGAGAGGAGAAGG + Intronic
1168355200 19:55695959-55695981 GCTGTAGCCCACACAGGTCCAGG + Intronic
925059009 2:876613-876635 TCTGAGGCCCATCAAGGAGCAGG - Intergenic
925471905 2:4172239-4172261 GCTGGAGCCCTCAGAGGAGCAGG + Intergenic
925959311 2:9001021-9001043 GCCTAGGCCCACACAGGGTCAGG + Intronic
926143466 2:10382740-10382762 ACTGGGTCCCACACGGGAGCAGG - Intronic
926199687 2:10785810-10785832 GCTGAGGCACACCCAGGAGGTGG - Intronic
926802552 2:16671915-16671937 GCTGAGGCCTCCCCAGAAGCTGG - Intergenic
927434892 2:23058388-23058410 GCTGACCCCCACACAGGGCCAGG - Intergenic
928155850 2:28875760-28875782 TCTGAAGCCCAGACAGGAGCAGG - Intergenic
929433296 2:41907137-41907159 ACTGAGGCCCAAACAGAAGTGGG - Intergenic
929514317 2:42592649-42592671 GCTTAGGCCTACACAGGGTCAGG + Intronic
932579623 2:72984900-72984922 GCTGGGGCCTGCAGAGGAGCTGG + Intronic
932749560 2:74362748-74362770 GGTGAGGCCCACCAAGGCGCAGG + Intronic
932775310 2:74524995-74525017 GCAGAGGCCCCCACCTGAGCAGG + Exonic
933433631 2:82216219-82216241 GCTTAGGCCTACACAGGATCAGG + Intergenic
934538998 2:95159397-95159419 GGTGAGAGCCTCACAGGAGCAGG + Exonic
934555521 2:95285166-95285188 GAAGGGGCCCACAGAGGAGCTGG + Intronic
935083302 2:99820816-99820838 GCCTAGGCCCACACAGGGCCAGG + Intronic
937046843 2:118856195-118856217 ACTGAGGCCCAGAGAGCAGCGGG - Intergenic
937630628 2:124097554-124097576 GCTAAGGACCACACAGGCTCTGG - Intronic
937849348 2:126619128-126619150 GCTGAGGCTCAGAGAGGTGCTGG - Intergenic
940591159 2:155729537-155729559 GCTGAGGCTGGCACGGGAGCAGG - Intergenic
941594130 2:167454878-167454900 GCTGAGGCCCAAACATTGGCTGG - Intergenic
941809476 2:169740862-169740884 GCTGAGGCCTATACAGGGTCAGG + Intronic
945637743 2:212378005-212378027 GCCTAGGCCTACACAGGATCAGG + Intronic
945906026 2:215594253-215594275 GTCGAGGCCTACACAGGATCAGG - Intergenic
946191018 2:218008060-218008082 ACTGAGGCTCACACAGGGCCTGG - Intergenic
946826010 2:223678544-223678566 ACTGAGGCTGACACTGGAGCAGG - Intergenic
947586523 2:231360204-231360226 GCTGATGCCCACCCAGAACCAGG - Intronic
948925012 2:241090266-241090288 GCTTATGCCTACACAGGGGCAGG + Intronic
1168823367 20:792376-792398 GCTGAGGCCGCCACAGGGGGCGG - Intergenic
1168886800 20:1266005-1266027 GCTGAGGCCCAGAGAGGTGAAGG + Intronic
1168951911 20:1808188-1808210 GTTGAGGACCACACAGGACAAGG + Intergenic
1168952480 20:1811819-1811841 GCAGAGAAGCACACAGGAGCTGG + Intergenic
1169738779 20:8867259-8867281 GCTGAGGCCAACACAAGGGCAGG + Intronic
1169799443 20:9499905-9499927 GCTGAGGAGCAGACAGGGGCAGG + Intergenic
1171854268 20:30330491-30330513 GCTGAGGGACACACAGGAGGGGG - Intergenic
1172121039 20:32598841-32598863 GCTGAGGGCTCCACAGGGGCAGG + Intronic
1172318389 20:33974883-33974905 GCCTAGGCCCACACAGGATCAGG - Intergenic
1172363869 20:34334007-34334029 GGAGAGGCCCACCCAGGAGCTGG - Intergenic
1172697546 20:36832917-36832939 ACTGAGGCTCACTGAGGAGCAGG - Intronic
1172842736 20:37911758-37911780 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
1173846196 20:46190283-46190305 ACTGAGGCCCACGGAGGGGCAGG + Intronic
1173962997 20:47089426-47089448 TCTGAGGCCCAAACAAGAGTGGG + Intronic
1174416096 20:50368198-50368220 GTTGATGCCCACACAGCAGCAGG - Intergenic
1174841313 20:53904008-53904030 GCCCAGGACCACACAGAAGCCGG + Intergenic
1175225152 20:57440243-57440265 GCTGAGGCCCAAAGATGAGAGGG - Intergenic
1175403772 20:58714576-58714598 GAAGAGGCCAGCACAGGAGCTGG - Exonic
1176096363 20:63346257-63346279 GTTGAAGCCCACACAGGCGCAGG + Exonic
1176430186 21:6570774-6570796 GCTGAGCAGCACACAGGAGGGGG - Intergenic
1176430316 21:6571382-6571404 GCTGCACTCCACACAGGAGCTGG + Intergenic
1176521848 21:7830141-7830163 GCTGTGGACCAGACAGGAGGGGG + Intergenic
1176687014 21:9858328-9858350 GCTGAGGCCTACACAGGGTCAGG - Intergenic
1177620319 21:23583222-23583244 GCTGAGGCTTACACAGGGTCAGG - Intergenic
1178306623 21:31496066-31496088 GCCTAGGCCTACACAGGAGCAGG - Intronic
1178655868 21:34460153-34460175 GCTGTGGACCAGACAGGAGGGGG + Intergenic
1178862148 21:36298398-36298420 GCTGTGGCCCTGGCAGGAGCTGG - Intergenic
1178907035 21:36645163-36645185 GATGAGGCCCACACACGTGATGG - Intergenic
1179181927 21:39053132-39053154 GCTGAGACACACACAGGATGCGG + Intergenic
1179517149 21:41916356-41916378 GATGAGGCCCACCCACGAGAGGG - Intronic
1179705580 21:43178236-43178258 GCTGAGCAGCACACAGGAGGGGG - Intergenic
1179705710 21:43178844-43178866 GCTGCACTCCACACAGGAGCTGG + Intergenic
1180000493 21:44993358-44993380 GGCGAGGCCCACACAGCGGCGGG - Intergenic
1180979492 22:19871986-19872008 GCTGAGGCCCCCACATGGGCTGG + Intergenic
1181511894 22:23393007-23393029 CCAGAGGCCCACACTGAAGCTGG - Intergenic
1182079340 22:27518148-27518170 ACTGAGGCTCAGACAGGAACAGG - Intergenic
1182097915 22:27638402-27638424 GCTGAGGCCCAGAGAGGGGTTGG + Intergenic
1182120208 22:27781544-27781566 ACTGAGGCCCAGAGAGGAACTGG + Intronic
1182879181 22:33718726-33718748 GCTGAGACCCACACAGGTTCAGG - Intronic
1183170129 22:36181588-36181610 GCTGAGGCCTGAAGAGGAGCTGG + Intergenic
1183280410 22:36929244-36929266 GCTGAGGCTCACAGAGGAGACGG + Intronic
1183314543 22:37129613-37129635 ACTGAGGCCCAGAGAGGTGCAGG - Intronic
1183410188 22:37650408-37650430 GGTGAGGCTCACACGGGAGTGGG + Intronic
1183439979 22:37817701-37817723 ACTGAGGCACACACAGGGACTGG - Intergenic
1183506029 22:38209427-38209449 GCTCATTCCCACACAGCAGCTGG - Intronic
1183538442 22:38416346-38416368 ACTGAGGCCCAGACAGGAAAGGG - Intergenic
1183593283 22:38794067-38794089 GCTCCGGCCCCCGCAGGAGCAGG - Exonic
1183775896 22:39965012-39965034 ACTGAGGCTCACAGAGGTGCAGG - Intronic
1183802451 22:40178540-40178562 GCTAAGGCCGACAAAGGATCTGG + Intronic
1183985010 22:41564766-41564788 GGTGAGGTCCAGAGAGGAGCAGG + Intronic
1184380602 22:44142942-44142964 GCTGCTGCCCCCACAGGGGCGGG - Intronic
1184475995 22:44721747-44721769 GCCGAGGCCCAGACAGGGGAGGG + Intronic
1184784318 22:46664444-46664466 GCTGAGGTCCACAGAGTACCTGG + Intronic
1184903330 22:47461569-47461591 TCTGAGGCCCACACTGGGGCTGG + Exonic
949132228 3:517458-517480 GCTGAGGCCCACAGAAGGTCAGG - Intergenic
950581725 3:13866702-13866724 GCAGAGGTCCATAAAGGAGCAGG + Intronic
953451355 3:43009191-43009213 GCTGAAGGATACACAGGAGCTGG - Intronic
954496759 3:50971906-50971928 GCTGAGGTCCCCACAGGAGGTGG + Intronic
954795223 3:53157989-53158011 CCTGAGGCCCACACAGCTGAAGG - Intronic
954930943 3:54280803-54280825 GCTGAGACCCAAAAAGGAGGAGG - Intronic
954942309 3:54385334-54385356 GCTGAGGCTCAGACAGGGGAAGG + Intronic
956604831 3:71064164-71064186 ACAGAGCCCCACACCGGAGCAGG - Intronic
957044659 3:75364350-75364372 GGTGAGGCAAAAACAGGAGCCGG - Intergenic
957599738 3:82319208-82319230 TCTGTGGCCCACACTGGTGCTGG - Intergenic
960117118 3:113906385-113906407 GCCTAGGCCTACACAGGATCAGG - Intronic
961194908 3:124993498-124993520 GCAGAGGCATACACAGGAGGAGG - Intronic
961749240 3:129085870-129085892 GCAGAGGCCCAGGCAGGAGGTGG + Intergenic
961770997 3:129249830-129249852 GCTGAGGCCCAGTGAGGGGCAGG + Intronic
961824068 3:129589662-129589684 GCTGAGGCCCAAACACAAACGGG + Intronic
962835670 3:139186362-139186384 CCTGAGGCACAGACAGGAGGGGG - Intronic
962942979 3:140142385-140142407 GTTCAGGCCCACACTGGGGCAGG + Intronic
963875644 3:150471523-150471545 GCCTAGGCCTACACAGGATCAGG + Intergenic
964636535 3:158863745-158863767 GCCTAGGCCTACACAGGATCAGG - Intergenic
965632003 3:170742707-170742729 GCTGAGGCTCACACAGAACCAGG - Intronic
967054980 3:185823887-185823909 GCTGGAGCCCAGACAGGAGACGG - Intronic
967135804 3:186511713-186511735 ACTGAGCCCCAAACAGGGGCAGG - Intergenic
967316373 3:188154638-188154660 GCTGAGGCCCAGAGAGAAGGAGG + Intronic
967728884 3:192888318-192888340 GCAGAGGCCCAGGCAAGAGCTGG + Intronic
967829874 3:193909714-193909736 GCTGAGGCCCACAGAGGAGTGGG - Intergenic
968009475 3:195264362-195264384 CCTGAGGCCCACACACTTGCAGG + Intronic
968459914 4:719655-719677 GCTGAGGGCTACAGTGGAGCTGG + Intronic
969363664 4:6681360-6681382 GCAGAGGGCTGCACAGGAGCTGG - Intergenic
969502001 4:7558981-7559003 GCTGAGGCCCAGATAGGGGCAGG - Intronic
969615720 4:8251620-8251642 GCTGAGGCCCAAAGAGGGGAAGG + Intergenic
971359103 4:25920325-25920347 GCCTAGGCCCACACAGGGTCAGG - Intronic
972787860 4:42344461-42344483 CCTGCCGCCCACACAGGCGCAGG - Intergenic
973987762 4:56372161-56372183 GAAGAGGCCCAAACAGCAGCTGG + Intronic
975082612 4:70299178-70299200 TCTGAGGCCAACACAGATGCTGG - Intergenic
975689515 4:76949996-76950018 GGTGAGGACCACAGGGGAGCCGG + Intronic
978509401 4:109500028-109500050 GCTTAGTCCTACACAGGATCAGG - Intronic
978867132 4:113526846-113526868 GCAGAGGCCCATGCAGGATCTGG + Intronic
979907739 4:126317648-126317670 AAAGAGGCCCACACAGGAACTGG + Intergenic
980043728 4:127965980-127966002 GCTGAGGCCCCCGTAGGCGCAGG - Intronic
980350405 4:131676439-131676461 GCCGAGGCCTACACAGGGTCAGG - Intergenic
981802977 4:148679679-148679701 GCTGAGGTCCACTCAGGGGTCGG + Intergenic
983754665 4:171320115-171320137 GCTGTGGGCCACATAGGAGCTGG + Intergenic
984264599 4:177482181-177482203 GCTTAGGCCTACACAGGGTCAGG - Intergenic
984441001 4:179770541-179770563 GAAGAGGCCCAGAGAGGAGCTGG + Intergenic
984937110 4:184899006-184899028 GTTCAAACCCACACAGGAGCAGG - Intergenic
985145309 4:186889645-186889667 GACGATGCCCACACTGGAGCTGG - Intergenic
985581313 5:696533-696555 CCCAGGGCCCACACAGGAGCTGG - Intergenic
985595942 5:787865-787887 CCCAGGGCCCACACAGGAGCTGG - Intergenic
985614112 5:909298-909320 GCTGAGCACCACACAGGGACAGG - Intronic
985660326 5:1153741-1153763 GTGGAGGCCAACAAAGGAGCTGG - Intergenic
986266219 5:6193525-6193547 CCTGCGGCCCACACAGGTGCTGG + Intergenic
986301579 5:6482161-6482183 GCTGAGGCACACAAGGGTGCTGG + Intronic
986738172 5:10682709-10682731 ACTGAGGCCCACACACTGGCAGG + Intronic
987040031 5:14053643-14053665 GCCTAGGCCCACACAGGGTCAGG - Intergenic
988540274 5:32102258-32102280 GCTGGGGCCCACCCAGGAGCAGG + Intronic
988931064 5:36035904-36035926 GCTCAGCCCCACACAGCGGCTGG - Exonic
988995884 5:36714594-36714616 GCCAAGGCCCACACAGGCCCAGG + Intergenic
990190203 5:53251255-53251277 GCTGAGGCCTACACAGGTTCAGG + Intergenic
992027609 5:72686024-72686046 TCTGATGCACACACAGGAGAAGG + Intergenic
992517945 5:77515311-77515333 GCTTAGGCCTACACAGGGTCAGG + Intronic
992533264 5:77672315-77672337 GCTGAGAGCCAAACAGGAGATGG - Intergenic
992730403 5:79660926-79660948 GCTTAGGCCCACACAGTATCGGG - Intronic
992943117 5:81782625-81782647 GCCGATGCCTACACAGGATCAGG + Intergenic
997584606 5:135036895-135036917 CCTGAGACCCAAAGAGGAGCTGG + Intronic
998153296 5:139769457-139769479 GCTGCCCCCCACAGAGGAGCTGG - Intergenic
998154443 5:139776403-139776425 CCTGAGGCCCAGAGAGGAGCAGG + Intergenic
999240690 5:150125672-150125694 CCTGAGGCCCAGAGAGGGGCAGG + Intronic
999244569 5:150147153-150147175 GCTGGGGCCCCCACAGGGGCAGG - Intronic
999411192 5:151351218-151351240 ACTGAGGCCCAGATAGGAGAAGG + Intergenic
999730105 5:154470579-154470601 ACTGAGGCTCACAAAGGAGAGGG - Intergenic
1000310640 5:160041008-160041030 GCCTAGGCCTACACAGGATCAGG + Intronic
1000769761 5:165338219-165338241 GCTTAGGCCTACACAGGGTCAGG - Intergenic
1001060162 5:168481544-168481566 GGTTAGGCCCAGACAGGAGCAGG + Intergenic
1001122389 5:168991455-168991477 GCTGTGGCCCACACAGCACCTGG - Intronic
1001381556 5:171309544-171309566 GCCGAGGCCCGCAAAGGAGGCGG - Exonic
1001471920 5:172020400-172020422 GCCGAGGCCCACATAGGGTCAGG - Intergenic
1001663137 5:173411522-173411544 GGTGAGGACCACATAGGAGCTGG + Intergenic
1002199736 5:177521007-177521029 GCTTAGGCCCAGAGAGGAGCTGG + Intronic
1002705773 5:181160245-181160267 GCTCAGGACCACACAGGCCCTGG - Intergenic
1002930392 6:1630439-1630461 GCTGGGCCCCACTCAGGAGGTGG - Intronic
1003572948 6:7268001-7268023 TCTGAGGCGAACACAGGAGAGGG - Intergenic
1005279240 6:24254096-24254118 GCCGAGGCCTACACAAGGGCTGG + Intronic
1006243842 6:32712220-32712242 GCTCAGGCCTACACAGGGTCAGG + Intergenic
1006436741 6:34029618-34029640 ACTGAGGCCCACAGAAGGGCAGG - Intronic
1006929763 6:37680720-37680742 GCTGAGGCCCAGAGGGGAGTTGG - Intronic
1010487872 6:76437240-76437262 GCTGAGGCCTACACGGGGTCAGG + Intergenic
1011399009 6:86939258-86939280 GCTGAGTCCCACTTAGGAGGTGG - Intronic
1012529990 6:100223876-100223898 GCCTAGGCCTACACAGGATCAGG - Intergenic
1013804902 6:113986231-113986253 GCTGAGACACAAGCAGGAGCTGG + Intronic
1014722212 6:124931035-124931057 GCTTAGGCCTACACAGGGTCAGG + Intergenic
1014797927 6:125747892-125747914 CCTGAGGCCGACAGGGGAGCTGG + Intronic
1015608910 6:134992540-134992562 GCCTAGGCCTACACAGGATCAGG - Intronic
1016716777 6:147242122-147242144 GCCTAGGCCTACACAGGATCAGG - Intronic
1018859740 6:167702979-167703001 GCCTAGGCCCACACAGGGTCAGG + Intergenic
1019013495 6:168862008-168862030 ACTGAAGCCCGCCCAGGAGCAGG + Intergenic
1019302651 7:315774-315796 CCTGGTGCCCACACAGGAGAAGG - Intergenic
1019492810 7:1323056-1323078 ACTGAGGCCCAGAGAGGCGCAGG + Intergenic
1019503817 7:1380511-1380533 GCTGAGCCCCAGAAAGCAGCAGG + Intergenic
1019705071 7:2493750-2493772 GATGAGGCCCAGAGAGGGGCTGG - Intergenic
1019712173 7:2522732-2522754 ACTGAGGCCCAGAGAGGTGCAGG - Intronic
1020422169 7:8020219-8020241 GCCTAGGCCCACACAAGATCAGG + Intronic
1020523532 7:9227077-9227099 GCTGAAGCAGACACAGGAACTGG - Intergenic
1021055825 7:16044755-16044777 GCTGAAGACCACCCAGGAGTAGG + Intergenic
1022021425 7:26402768-26402790 GCCTAGGCCTACACAGGATCAGG - Intergenic
1022860648 7:34363195-34363217 GAGGAAGCCCCCACAGGAGCTGG + Intergenic
1023527933 7:41124322-41124344 GCTTAGGTCCACACAGGGTCAGG - Intergenic
1024001347 7:45191247-45191269 GCTGAGCCCCACAAAGAACCAGG + Intergenic
1024390930 7:48811292-48811314 AGTGAGGCCCACACAAGGGCAGG + Intergenic
1025254514 7:57374545-57374567 GTTGATGCCCAGACAGCAGCAGG + Intergenic
1025610384 7:63072036-63072058 GGTGGGGCTCACACAGGAGGGGG + Intergenic
1025834973 7:65085741-65085763 GCTGAGCCCAAGCCAGGAGCAGG - Intergenic
1025904744 7:65775220-65775242 GCTGAGCCCAAGCCAGGAGCAGG - Intergenic
1025968553 7:66299579-66299601 ACTGAGGCCCACACAGGAGATGG - Intronic
1026419902 7:70223807-70223829 GCCGAGGACTACACAGGAACAGG - Intronic
1026441300 7:70446729-70446751 CCTGAAGCACACACTGGAGCTGG - Intronic
1027303497 7:76867330-76867352 GATGGGGCCCTGACAGGAGCAGG + Intergenic
1028509855 7:91612324-91612346 TCTGAGGCATACACTGGAGCAGG - Intergenic
1029796035 7:102895535-102895557 GCTGAGGCCCACTCAAGCTCAGG - Intronic
1030202792 7:106922364-106922386 GCAGAGGCGCAAAGAGGAGCGGG + Intergenic
1030278376 7:107743987-107744009 CCTGAGTCCCTCACAGGAGTTGG + Exonic
1030438510 7:109555500-109555522 GCAGAGGCACAAAGAGGAGCTGG + Intergenic
1031891958 7:127304827-127304849 GCCTAGGCCTACACAGGATCAGG - Intergenic
1032097742 7:128947823-128947845 GCTGGAGGCCACCCAGGAGCAGG + Exonic
1032735076 7:134685004-134685026 GCCCAGGCCTACACAGGATCAGG + Intergenic
1032760477 7:134936300-134936322 TCTGAGGCACACACAGGAGCGGG + Intronic
1033156490 7:138961355-138961377 ACTGAGGCAAACACAGCAGCTGG + Intronic
1034069124 7:148165644-148165666 ACTGAGGCCCAAATAGGACCTGG + Intronic
1034082445 7:148291986-148292008 GGTGAGGCAAACACAGCAGCAGG + Intronic
1034162119 7:149001585-149001607 GGAGAGGCCGACTCAGGAGCTGG - Intergenic
1034402151 7:150869657-150869679 GCTGCTGCCCACGCAGGATCTGG + Intergenic
1035237601 7:157508949-157508971 GCTGGGGGACACACAGGAGGAGG + Intergenic
1035934374 8:3820413-3820435 GCTTAGGCCTACACAGGGTCAGG + Intronic
1036207399 8:6815306-6815328 GCTCAGGCCTGCACTGGAGCTGG + Intronic
1036207550 8:6816044-6816066 GCTGAGGAGTACCCAGGAGCAGG + Intronic
1036444990 8:8813514-8813536 GCTCAGGCCTACACAGGGTCAGG - Intronic
1037112628 8:15182983-15183005 GCTTAGGCCTACACAGGATCAGG + Intronic
1037192248 8:16140812-16140834 GCAGAGGCCCAAACAGCACCAGG + Intronic
1037993323 8:23336080-23336102 CATGACGCCCACACAGGGGCGGG + Intronic
1038493414 8:27985687-27985709 ACTGAGGCCCACAGAGGCCCAGG + Intronic
1038628130 8:29214419-29214441 GCCTAGGCCCACACAGGGTCAGG + Intronic
1038922881 8:32104734-32104756 GCCTAGGCCCACACAGGGTCAGG + Intronic
1040047068 8:42975091-42975113 GGTGGGGCGCACCCAGGAGCGGG + Intronic
1040894860 8:52355329-52355351 GAGGAGGCCCACACAGGCCCCGG - Intronic
1041178117 8:55218896-55218918 TCTGAGACGCACACAAGAGCAGG + Intronic
1042216408 8:66432814-66432836 ACTGAGGCCCAGAGAGGACCTGG + Intronic
1044546250 8:93463508-93463530 GCTGAGGCCTACACAGGGTCAGG + Intergenic
1044932200 8:97261039-97261061 GCAGAGGGACACACAGGTGCAGG - Intergenic
1045501157 8:102745434-102745456 GCTGAGGCCCAGACAGGGTGGGG - Intergenic
1046410291 8:113833031-113833053 GCAGAGGCACAAAGAGGAGCTGG + Intergenic
1047262539 8:123275007-123275029 GCTGCGGCCCGCGGAGGAGCGGG - Intronic
1047780426 8:128106599-128106621 GCTGTGGCCTACACTGAAGCAGG - Intergenic
1048002695 8:130392708-130392730 CCTGAGGCCCTCACAGAAGCAGG - Intronic
1048490262 8:134885534-134885556 GCCGAGGCCCAGGTAGGAGCAGG + Intergenic
1048712361 8:137226694-137226716 GCTGAGGCCCAAAGAAGACCAGG - Intergenic
1048789660 8:138088485-138088507 GCTGAGGCCCACCCAGGCTCAGG + Intergenic
1049203009 8:141350985-141351007 ACTGAGGCCCAGAGAGGGGCAGG + Intergenic
1049252832 8:141598326-141598348 GTAGAGGCCCACACGGGAGACGG - Intergenic
1049604986 8:143525212-143525234 CCTGAGGCTCCCCCAGGAGCTGG + Intronic
1049624655 8:143614584-143614606 GCTGAGGCCCAGCCAGGAGTCGG - Intronic
1049879618 8:145052886-145052908 GCTGAGGCCCAGGCAAGGGCGGG + Exonic
1053001131 9:34577890-34577912 GCGGAGGCCGAGAAAGGAGCGGG + Intronic
1053214303 9:36258180-36258202 CCCGAGGCCCACACTGGACCCGG - Intronic
1053782306 9:41623270-41623292 GCTGAGGCCTACACAGGGTCAGG + Intergenic
1054170256 9:61833425-61833447 GCTGAGGCCTACACAGGGTCAGG + Intergenic
1054180485 9:61905790-61905812 GCTGAGGGACACACAAGAGGGGG - Intergenic
1054472870 9:65552199-65552221 GCTGAGGGACACACAAGAGGGGG + Intergenic
1054657106 9:67675352-67675374 GCTGAGGGACACACAAGAGGGGG + Intergenic
1054667282 9:67747390-67747412 GCTGAGGCCTACACAGGGTCAGG - Intergenic
1057273399 9:93663470-93663492 CCTGAGCCCCACACAGAAGTGGG - Intronic
1057452803 9:95180152-95180174 GCTGAGGCCTACACAGGGTCAGG + Intronic
1057574149 9:96228003-96228025 GCAGAGGCCCTCACTGGGGCAGG - Intergenic
1057719153 9:97518322-97518344 CCTGAGGCCAACAGAGCAGCTGG + Intronic
1058892257 9:109371148-109371170 GCAGAGGACCACACAGGACGAGG + Intergenic
1059433255 9:114262265-114262287 ACTGAGGCCCAGAGAGGAGATGG + Intronic
1060198856 9:121640241-121640263 GCCCAGGCCCACACAGCAGCGGG - Intronic
1060225251 9:121786439-121786461 GCAGAGCCACACACCGGAGCAGG + Intergenic
1060413041 9:123412413-123412435 GCTGAGTCCCACATAGCAGGAGG - Intronic
1060490278 9:124079120-124079142 ACTGAGGCCAAGACAGGGGCAGG - Intergenic
1060754945 9:126205926-126205948 GCTGAGTCCCACAGAGAAGCTGG + Intergenic
1060771954 9:126338260-126338282 GCTGAGGCAGACAAAGGAGCCGG - Intronic
1061141242 9:128768475-128768497 ACTGAGGCCCAGAGAGGAGATGG + Intronic
1061281121 9:129598007-129598029 GCTGAGGCCCAGAGAGGGCCAGG - Intergenic
1061406124 9:130393943-130393965 GCTCACGGCCACACAGGAGTAGG - Intronic
1061453732 9:130682413-130682435 ACTGAGGCCCAAAGAGGTGCAGG - Exonic
1061595281 9:131624862-131624884 GCTGAGGCCATCACACAAGCTGG + Intronic
1061725646 9:132580685-132580707 GCTGAGCCCGACGTAGGAGCCGG + Intergenic
1062107311 9:134762776-134762798 GCTGAGGCCCACACAGGAGCAGG - Intronic
1062288706 9:135785179-135785201 GCTGCAGTCCACACAGCAGCAGG + Intronic
1062322386 9:135996766-135996788 CCTGAGCCCCACACAGAGGCTGG - Intergenic
1062333405 9:136054409-136054431 GCTGAGAGCCGGACAGGAGCTGG + Intronic
1062393745 9:136344235-136344257 GGTGGGGCGCAGACAGGAGCAGG + Intronic
1062469466 9:136696250-136696272 GCTGTGGCACAGACAGCAGCTGG - Intergenic
1062486217 9:136777619-136777641 CCTGAGGCCCAGGGAGGAGCCGG - Intergenic
1062501721 9:136854676-136854698 GGTGAGGCCCACAGAGGACCCGG + Exonic
1062566230 9:137165105-137165127 GCAGCGGCCCATGCAGGAGCAGG + Intronic
1062623926 9:137434552-137434574 CCTGAGGCCCCATCAGGAGCAGG + Exonic
1186644216 X:11489267-11489289 GCTGAGGCCCAATTAGGAGATGG + Intronic
1189295128 X:39912451-39912473 GCTGAAGCCCAAAAGGGAGCTGG - Intergenic
1192181832 X:68920982-68921004 GATGAGGCCCAGAGAGGGGCAGG - Intergenic
1192569779 X:72193481-72193503 GCTTAGGCCCACACAGGGTCAGG - Intronic
1195127765 X:101824945-101824967 GCTGAGGCCAGCACAGGAGGAGG - Intergenic
1195178233 X:102331635-102331657 GCTGAGGCCAGCACAGGACGAGG + Intergenic
1195180631 X:102355456-102355478 GCTGAGGCCAGCACAGGACGAGG - Intergenic
1197770732 X:130087565-130087587 GCTGAGGCACACCCTGGAGGCGG - Intronic
1198427424 X:136533765-136533787 ACTGAGGCCCATAGAGGAGAAGG + Intronic
1199700953 X:150375175-150375197 ACTGAGGCCCAGAGAGGAGCAGG + Intronic
1199896108 X:152129436-152129458 CAGGAGGCCCACACAGGGGCAGG - Intergenic
1200076137 X:153552098-153552120 GCTGAGGCCCCCACACCAGCAGG - Intronic
1200148888 X:153941911-153941933 GCTGGGGGCCACCCAGGAGGAGG - Intronic
1200988153 Y:9325533-9325555 GCAGAGGCCCTCACAAGTGCAGG + Intergenic
1202091998 Y:21201085-21201107 GCAGAGGCACAAAGAGGAGCTGG - Intergenic
1202377527 Y:24250693-24250715 GCAGAGGCCCAGACAGGACCAGG + Intergenic
1202493254 Y:25419429-25419451 GCAGAGGCCCAGACAGGACCAGG - Intergenic