ID: 1062108127

View in Genome Browser
Species Human (GRCh38)
Location 9:134766830-134766852
Sequence CCTGGGGCTGCTCTCTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 1, 2: 1, 3: 59, 4: 400}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062108117_1062108127 16 Left 1062108117 9:134766791-134766813 CCATCAGAGTCAACCTCCACAGC 0: 1
1: 0
2: 0
3: 14
4: 235
Right 1062108127 9:134766830-134766852 CCTGGGGCTGCTCTCTGTGGTGG 0: 1
1: 1
2: 1
3: 59
4: 400
1062108122_1062108127 -6 Left 1062108122 9:134766813-134766835 CCTCAGAGGCGCTGAGTCCTGGG 0: 1
1: 0
2: 3
3: 31
4: 266
Right 1062108127 9:134766830-134766852 CCTGGGGCTGCTCTCTGTGGTGG 0: 1
1: 1
2: 1
3: 59
4: 400
1062108119_1062108127 3 Left 1062108119 9:134766804-134766826 CCTCCACAGCCTCAGAGGCGCTG 0: 1
1: 0
2: 1
3: 40
4: 634
Right 1062108127 9:134766830-134766852 CCTGGGGCTGCTCTCTGTGGTGG 0: 1
1: 1
2: 1
3: 59
4: 400
1062108120_1062108127 0 Left 1062108120 9:134766807-134766829 CCACAGCCTCAGAGGCGCTGAGT 0: 1
1: 0
2: 4
3: 37
4: 448
Right 1062108127 9:134766830-134766852 CCTGGGGCTGCTCTCTGTGGTGG 0: 1
1: 1
2: 1
3: 59
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062108127 Original CRISPR CCTGGGGCTGCTCTCTGTGG TGG Intronic
900156398 1:1204987-1205009 CCTGGGGCTGCACCCTGTTCTGG - Intronic
900287805 1:1909850-1909872 CCTGGGGCCGCTCTCGCTGCTGG + Intergenic
900543581 1:3216367-3216389 TGTGGGTCTCCTCTCTGTGGAGG - Intronic
900599704 1:3497770-3497792 CTTGGGTCTGCTGTCTGAGGGGG - Intronic
900605443 1:3521654-3521676 GCGGGAGCTGCTCTCTGTGGGGG - Intronic
900730854 1:4258651-4258673 CCGGTGGCGGCTGTCTGTGGGGG - Intergenic
901129986 1:6956180-6956202 CCAGAGGCTGCTCACTATGGTGG + Intronic
901960501 1:12822796-12822818 CCTGGGGCTCTGCTCTTTGGGGG + Intergenic
901982495 1:13047664-13047686 CCTGGGGCTCTGCTCTTTGGGGG + Intronic
901986525 1:13079670-13079692 CCTGGGGCTCTGCTCTTTGGGGG - Intergenic
901995287 1:13147097-13147119 CCTGGGGCTCTGCTCTTTGGGGG + Intergenic
901999592 1:13181255-13181277 CCTGGGGCTCTGCTCTTTGGGGG - Intergenic
902018070 1:13324380-13324402 CCTGGGGCTCTGCTCTTTGGGGG - Intergenic
902537745 1:17131043-17131065 CTTGTGGGTACTCTCTGTGGGGG - Intergenic
902816698 1:18920608-18920630 CCTGAGCAGGCTCTCTGTGGTGG - Intronic
902886284 1:19407329-19407351 CCTGGGACTGCTTTCTGGTGGGG - Intronic
903754359 1:25650531-25650553 CCTGGACCTGCTCTCTCTGCGGG - Intronic
903833490 1:26188653-26188675 CCGTGGGCTGCGCTGTGTGGGGG - Exonic
903910804 1:26723483-26723505 CCTGGGGCTGTTTTCTGCTGGGG + Intronic
904011838 1:27394296-27394318 CCTGGGGCTGCTGCCTGTGCTGG + Exonic
904133963 1:28296759-28296781 CCTTGGACTCCTCTGTGTGGGGG + Intergenic
904663345 1:32101484-32101506 CCTGGCACTGCTCTGTTTGGAGG + Intronic
905010029 1:34741022-34741044 CCTGGGGATGCCCTATGTGTTGG - Intronic
905309178 1:37037631-37037653 ACTGGGGCTGCTGCCTGCGGTGG + Intergenic
905632163 1:39524899-39524921 CCAGGGGCTGCTCTCAGGGAAGG + Intronic
906670667 1:47652118-47652140 TGTGGGGCAGCTCTCTGTGTGGG - Intergenic
907300140 1:53481887-53481909 CCAGGAGATGCTGTCTGTGGGGG + Intergenic
907726747 1:57027236-57027258 CCTGGGGCTCCTTTCTCTTGTGG - Intronic
907868696 1:58423539-58423561 CCTGGTGCTGCTCTGCTTGGAGG - Intronic
908184728 1:61641866-61641888 CCTGGGCCTGCTCTCTGCGGCGG - Intergenic
910448633 1:87325214-87325236 CCTGGGCCAGTTTTCTGTGGTGG - Intergenic
912460972 1:109831164-109831186 CCTGGGTCTACCCTCAGTGGAGG - Intergenic
912488982 1:110050815-110050837 CCTGGGGCTGCTCTGAGAGCAGG + Intronic
912568996 1:110607958-110607980 CCTGCGGCTCCTCTCGGTGGGGG - Intronic
913961401 1:143340282-143340304 CCAGCAGCTGCTCTCTGTGATGG - Intergenic
914055754 1:144165855-144165877 CCAGCAGCTGCTCTCTGTGATGG - Intergenic
914123392 1:144800507-144800529 CCAGCAGCTGCTCTCTGTGATGG + Intergenic
914247298 1:145895860-145895882 CTTGGGGCTCTTCTCTCTGGGGG - Intronic
914979356 1:152399067-152399089 CCTGGGGCTGCTCTCACTACTGG + Intergenic
915722375 1:157994256-157994278 CCTGGGGCTGCCCCCTCTAGAGG + Intronic
915726965 1:158024952-158024974 ACTTGGGCTGCTCACAGTGGTGG - Intronic
916074778 1:161193943-161193965 CCTGGAGCTGGTCCATGTGGAGG + Exonic
916497101 1:165356133-165356155 CCTGGCGCTGCGCTCTGTTGGGG + Intronic
916563017 1:165949501-165949523 CCTGGGGCCCCTCCCTTTGGAGG - Intergenic
918598227 1:186318732-186318754 CCTGGGGCTGCTACTTGTAGTGG + Exonic
919818077 1:201454458-201454480 CCTTGGGCTGCTCTCTGTGGTGG - Intergenic
919929262 1:202210535-202210557 CCTCGGGCTCCTGCCTGTGGTGG - Intronic
920293742 1:204942968-204942990 CCAGTGCCTGCTCTCTGAGGGGG - Intronic
920670445 1:208000123-208000145 CCTGTGGCTGCTATCTCTGCAGG + Intergenic
920866845 1:209760192-209760214 TCTGGAGCTGCTCTCTCTGTTGG - Exonic
922027029 1:221759895-221759917 CTTGGGGCTGCTTCCTGTGAAGG + Intergenic
923069631 1:230550582-230550604 GCTGGTGCTGCTCAGTGTGGAGG - Intergenic
923208576 1:231782061-231782083 CCTGTAGCTGCTTTCAGTGGGGG + Intronic
924647026 1:245887403-245887425 CTTGGGGCTGCTGTGTGTGGAGG + Intronic
924940637 1:248810784-248810806 GCTGGAGCTGCTCCCTGCGGAGG + Exonic
1062770472 10:96353-96375 CCTGTGGGGGCTCTGTGTGGGGG + Intergenic
1063024828 10:2167432-2167454 CCTGGGCCTACACTCTGTGAAGG + Intergenic
1063127696 10:3150139-3150161 CCTGGGGCAGCCTTCTGTTGTGG - Intronic
1064311019 10:14211944-14211966 CCTGGTGTTTCTCTCTGTGATGG + Intronic
1065818891 10:29507040-29507062 CTGGGGTCTGCTCTCTGGGGTGG + Intronic
1067029849 10:42872679-42872701 CCAGCAGCTGCTCTCTGTGATGG - Intergenic
1067445117 10:46337079-46337101 CCTGGGGCCGCACTGTGAGGTGG + Intergenic
1069115879 10:64506015-64506037 CATTGGGCTGCTCCCTGTGTTGG - Intergenic
1069504908 10:68989051-68989073 CCTGGGGCTGCCGGCTGAGGTGG + Exonic
1070556494 10:77531893-77531915 CCTGGGGCTGCTGACTCTGCAGG - Intronic
1071145452 10:82565086-82565108 CCTGCTGCTGCTTTCTCTGGCGG - Intronic
1071563107 10:86658213-86658235 CCTGGGGATGCCCTCAATGGAGG + Intronic
1073327056 10:102649316-102649338 CCTGGGACTTCCCCCTGTGGTGG + Intronic
1073424782 10:103449815-103449837 CCAGGAGCTGTTCTCTGTGGTGG - Exonic
1074869613 10:117566434-117566456 CCTGGGGATGCTCTGATTGGGGG + Intergenic
1075700238 10:124464535-124464557 CCTGGGTCTGCTCTCAGTGTTGG + Intronic
1076133579 10:128029782-128029804 CCTGGTGATGCCCACTGTGGGGG - Intronic
1076197831 10:128532799-128532821 CCTGGAGCTGCTCTCTTGGTGGG + Intergenic
1076301299 10:129428772-129428794 CCTGGAAATGCTCTCTGTGATGG - Intergenic
1076342132 10:129756408-129756430 CTCGGGGCTGCCCTCTGGGGAGG + Intronic
1076569078 10:131420486-131420508 CCCAGCGCTGCTCTCTCTGGGGG + Intergenic
1076691098 10:132224241-132224263 CTTGGGGCTGCCATCTGCGGAGG + Intronic
1076776350 10:132700074-132700096 CCTGAGGCTGCTCTTCCTGGGGG - Intronic
1077106265 11:843795-843817 CCTGGGGCTTCTGGCTGGGGTGG + Intronic
1077198794 11:1295226-1295248 CCGAGGGCTGCTCTGTGGGGAGG + Intronic
1077392990 11:2308495-2308517 CGGGGGGCTGGTCACTGTGGGGG - Intronic
1077508018 11:2941087-2941109 CATGGGGATGCTCCCTGGGGCGG + Intergenic
1077838320 11:5944936-5944958 ACTGTGGCTGCTGTCAGTGGAGG - Intergenic
1078413694 11:11148226-11148248 CCTGGGGACTCTCTCTGGGGAGG + Intergenic
1079005641 11:16789660-16789682 CCTGGGGATGGCCTCTGGGGTGG - Intronic
1079095594 11:17508046-17508068 CCTGGGGCCTCTCTCTGTGAAGG - Intronic
1079129063 11:17737115-17737137 CCGGAGGCTGCTCCCTGAGGAGG - Intronic
1079446436 11:20560776-20560798 CCTGGAGGTACACTCTGTGGAGG + Intergenic
1080057151 11:27918087-27918109 CCTGGGACTTCTCTCTGAGGTGG - Intergenic
1080878244 11:36296133-36296155 ACAGCGGCTGCTCTGTGTGGTGG - Intergenic
1083167985 11:60903292-60903314 CCAGGTGCTGCTCTCAGTGCTGG + Intronic
1083473795 11:62902389-62902411 CCTGGGCTGGCTCTCTGCGGGGG + Intergenic
1083541706 11:63515993-63516015 ACTGGGGCTGCTTCCTGTAGAGG - Intronic
1083720764 11:64602414-64602436 CTGGGGGCTGCTTTCTGGGGTGG + Intergenic
1083838539 11:65288953-65288975 CCTCTGGCAGTTCTCTGTGGAGG - Intronic
1083856215 11:65394276-65394298 CCTGCGGCTGCTCTATGAGGAGG + Exonic
1083964000 11:66031645-66031667 TCTGTGGATGCTTTCTGTGGAGG - Intergenic
1084117361 11:67050068-67050090 CCTTGGCCTGATCGCTGTGGGGG + Exonic
1084154094 11:67304096-67304118 CCTGGGGCTGCTCTCTCCGCAGG + Exonic
1084167491 11:67382651-67382673 CCTTGGGCAGGCCTCTGTGGGGG - Intronic
1084326365 11:68402668-68402690 CCTGCAGTTGCTCTGTGTGGTGG + Intronic
1084555495 11:69873527-69873549 CCTGGAGCTGCTGTCTATTGTGG - Intergenic
1084675795 11:70633684-70633706 CCAGGGGCCTCTCTCTGGGGTGG - Intronic
1086096268 11:83052993-83053015 CCTGTGTCTTCTCTCTGAGGTGG - Intronic
1086338956 11:85827483-85827505 CCAGGGGCTGTTCTCTCTGCTGG + Intergenic
1088819730 11:113447138-113447160 GGTGGGGCTGCTGTCTTTGGAGG - Intronic
1089634410 11:119803279-119803301 CCCTGGGCTGCTCTCTAGGGTGG - Intergenic
1090715841 11:129430049-129430071 CCAAGGGCTGCCCTCTGTGGAGG - Intronic
1090841038 11:130487641-130487663 CCTGCGGCTGCAGTCTGGGGTGG - Intergenic
1091453353 12:587275-587297 CCTGGGCCTGCTTCCTGTGGAGG - Intronic
1091464150 12:669258-669280 CCTGGGGATGCTCTTGGTGGTGG + Intergenic
1091910450 12:4226623-4226645 GCTGGGGCTGCTCCCTGTACTGG - Intergenic
1095768409 12:45923081-45923103 CCTGGGGCTGCTGTCGGAGCAGG + Exonic
1096799979 12:54104036-54104058 CTTGGGGCTAGTCTATGTGGGGG - Intergenic
1097262772 12:57728767-57728789 CCTGGGGCTGGTGGCGGTGGGGG + Intronic
1098300323 12:69047640-69047662 CCAGGCGATGCTATCTGTGGAGG + Intergenic
1100891142 12:99127237-99127259 CCTGGAGATGCTCGCTGAGGTGG + Intronic
1101397691 12:104362996-104363018 CCTGAGGCTTCTCTCTGCTGCGG + Intergenic
1101507058 12:105357008-105357030 TCTGTGGCTGCTCTTTGGGGTGG - Intronic
1102413736 12:112742633-112742655 CCTGGGGCTGCTGTCAGGGCTGG + Intronic
1103141212 12:118549943-118549965 CCTAGGGCTGCTCTCTGTCTCGG + Intergenic
1103483099 12:121263985-121264007 CCTGCAGCTGCCCTCTGCGGAGG - Intronic
1103865241 12:124046326-124046348 CCTGGGACTCCGCTCTGTGTGGG + Intronic
1104415276 12:128592737-128592759 CCTGGGGGTCCTCGCTATGGGGG - Intronic
1104917248 12:132272086-132272108 TCTGGGGCTGCTCTGAGTTGGGG - Intronic
1105016539 12:132789107-132789129 CCTGGGCCACCTCTCTGTGCAGG + Exonic
1105673838 13:22648694-22648716 CCCTGCTCTGCTCTCTGTGGTGG + Intergenic
1106403274 13:29450130-29450152 AGTGGGTCTGCTCTCTCTGGGGG + Intronic
1106723019 13:32455369-32455391 AATGGGGTTGCTGTCTGTGGTGG - Intronic
1107682490 13:42866116-42866138 CATGTGGTTGCTCTCTGTTGAGG + Intergenic
1107728868 13:43328132-43328154 CCTGGGGCTGCTCTAAGTGCTGG + Intronic
1113680585 13:112241406-112241428 CCTGGGGCTGCTCTGGAGGGAGG - Intergenic
1113894601 13:113755543-113755565 CCCTGGGCTGCTCTCAGTGGTGG + Intergenic
1113903996 13:113811110-113811132 GCTGGGGCTGCTCCTTCTGGTGG + Intronic
1114628692 14:24146240-24146262 CCGGGTACTGCTCTCTGTGTAGG - Exonic
1115089046 14:29551717-29551739 CCTGGGGTCTGTCTCTGTGGAGG - Intergenic
1115664498 14:35533568-35533590 CCTGTGGCTGCTGTCGGCGGCGG - Intergenic
1116300540 14:43175811-43175833 CCTGGGGCTGCTGTTTCTGGTGG - Intergenic
1116706687 14:48311704-48311726 CTTGGTTCTGCTCTCTGGGGAGG + Intergenic
1118605147 14:67497289-67497311 CCTGGGTCTCCTCTCTGTAAAGG - Intronic
1118921001 14:70149891-70149913 CCTGGGGCTGCTCTGTCTTTGGG + Intronic
1119759211 14:77139708-77139730 CCTGCGGCTGCTCAACGTGGTGG - Exonic
1119850385 14:77862425-77862447 CCTGGCCCTTCTCTTTGTGGGGG + Intronic
1121114135 14:91331685-91331707 CTTGGGGCAGCTCCCTGTTGGGG + Intronic
1121501128 14:94439177-94439199 TCTTGCGATGCTCTCTGTGGTGG - Intergenic
1121502382 14:94448504-94448526 CCTGGCCCTGCTCTCTCTTGGGG - Exonic
1122010715 14:98744584-98744606 AATGGAGCTGCTCTCAGTGGGGG - Intergenic
1122037653 14:98960468-98960490 CCTGGGCCTGCTCCAGGTGGTGG - Intergenic
1122338523 14:101009181-101009203 CCTGGGTCTTCTCCCTGTGCCGG - Intergenic
1122800128 14:104225237-104225259 CCTGGGGCTGCTCTGAGTGAAGG + Intergenic
1122800136 14:104225272-104225294 CCTGGGGCTGCTCTGAGTGAAGG + Intergenic
1122800178 14:104225447-104225469 CCTGGGGCTGCTCGGAGTGAAGG + Intergenic
1122800186 14:104225482-104225504 CCCGGGGCTGCTCTGAGTGAAGG + Intergenic
1122800194 14:104225517-104225539 CCCGGGGCTGCTCTGAGTGAAGG + Intergenic
1122800203 14:104225552-104225574 CCTGGGGCTGCTCTGAGTGAAGG + Intergenic
1122800245 14:104225727-104225749 CCTGGGGCTGCTCGGAGTGAAGG + Intergenic
1122800271 14:104225832-104225854 CCTGGGGCTGCTCTGAGTGAAGG + Intergenic
1122800326 14:104226077-104226099 CCTGGGGCTGCTCTGAGTGAAGG + Intergenic
1122800333 14:104226111-104226133 CCCGGGGCTGCTCTGAGTGAAGG + Intergenic
1123050027 14:105536876-105536898 CATGGGGCTGTTCTGTTTGGTGG - Intergenic
1123472920 15:20568258-20568280 CCTGGGACTGGGCTTTGTGGAGG + Intergenic
1123536217 15:21187194-21187216 CCTAGCCCTGCTCTCTGTGCTGG - Intergenic
1123645085 15:22432095-22432117 CCTGGGACTGGGCTTTGTGGAGG - Intergenic
1124004694 15:25786248-25786270 CCTGTGGCTGCTGGCTGGGGTGG - Intronic
1124283726 15:28384543-28384565 CCTGGGACTGGGCTTTGTGGAGG + Intronic
1124298971 15:28527070-28527092 CCTGGGACTGGGCTTTGTGGAGG - Intronic
1124404870 15:29383684-29383706 CCTGGTTCTGCCCCCTGTGGAGG - Intronic
1124453560 15:29821574-29821596 CCGGGAGCTGCTGTCTTTGGAGG - Intronic
1124639852 15:31391042-31391064 CATGGGGCTTCTCTATGGGGTGG + Intronic
1124959448 15:34383609-34383631 CCTGGGTCTGGGCTTTGTGGAGG - Intronic
1124976074 15:34529830-34529852 CCTGGGTCTGGGCTTTGTGGAGG - Intronic
1126798088 15:52276638-52276660 CCTGAGGCTGCTATCTTTAGAGG - Intronic
1127299558 15:57639571-57639593 CCTGGGATTGCTTCCTGTGGTGG + Intronic
1128608622 15:69056763-69056785 TCTGAGGCTGGTCCCTGTGGGGG - Exonic
1130088066 15:80795266-80795288 CCTCTGGCTGCTCTCTGTCTGGG + Intronic
1132421037 15:101669016-101669038 CCTGGGGCTGGTCTTTCAGGAGG + Intronic
1132433079 15:101776059-101776081 CCTGGGTCTGGGCTTTGTGGAGG - Intergenic
1132924775 16:2423386-2423408 CTTGGGTCTTCTCTCTTTGGTGG + Intergenic
1133334202 16:4996197-4996219 CCGGTGGCTGCTGTCTGGGGCGG + Intronic
1134268151 16:12709405-12709427 CCCAGGGCTCCTCTCCGTGGGGG - Intronic
1134863873 16:17586832-17586854 GCTTGGGCTGCTTTCTGAGGGGG + Intergenic
1136111725 16:28067684-28067706 TGTGGGGCTGGTCTCTCTGGAGG - Intergenic
1136537712 16:30910290-30910312 CCTGGGGCTGAGCCCTGGGGTGG + Intergenic
1138328175 16:56192144-56192166 CCAGGCTCTGCTCTCTGGGGGGG + Exonic
1138535248 16:57656505-57656527 CCCCGGGCTGCTCACTGAGGAGG - Exonic
1139375658 16:66494916-66494938 CCAGGGGCTTCTCTATGTGGTGG + Intronic
1140205020 16:72926699-72926721 GCTGGGCCTGCTGTCTGTGTTGG - Intronic
1140354863 16:74296953-74296975 CCTGGTGCTGCTCAGTGTGGTGG + Exonic
1141493317 16:84389676-84389698 CCTGGTGCTGGGCTCTGTGCTGG + Intronic
1141696298 16:85621255-85621277 CCTGGGTCTGTGCTCTGTTGGGG + Intronic
1141924212 16:87156653-87156675 CCTATGGCAGCTCTGTGTGGGGG - Intronic
1142400232 16:89854742-89854764 CCCTGGGCCGCTCTCTGGGGTGG - Intronic
1143015248 17:3888182-3888204 CCTGTGGCTTCTGCCTGTGGCGG - Intronic
1143847335 17:9782543-9782565 GATGGGGCTGCCCTCTCTGGGGG + Intronic
1143901168 17:10175948-10175970 CCTGGGGCCCCTCACTGTGCTGG + Intronic
1143927996 17:10390062-10390084 CCTGAGGCTGCCCTCTGTATGGG - Intergenic
1144479832 17:15619758-15619780 CCTGGCACTGCTTTATGTGGAGG + Intronic
1144670075 17:17127909-17127931 CCCGGGGGCGCTCTCTGCGGGGG + Intronic
1144918470 17:18743978-18744000 CCTGGCACTGCTTTATGTGGAGG - Intergenic
1145056175 17:19705486-19705508 TCTAGGGCTGCTCAGTGTGGTGG - Exonic
1145922826 17:28623790-28623812 TGTGGGGCTGCTTTCAGTGGTGG + Exonic
1148767347 17:50046986-50047008 CCTTGGCCTTCTCCCTGTGGAGG - Intergenic
1148896128 17:50840223-50840245 ATTGGGGCTGCTCTCTGAGGTGG - Exonic
1149646715 17:58246491-58246513 CCTGGGGCTGGGCTCTGTTGGGG - Intronic
1151555980 17:74846988-74847010 ACTGGGGCTGGGCTCTGGGGTGG - Intronic
1151602300 17:75113801-75113823 CAAGGGGCAGCTGTCTGTGGGGG - Intronic
1151952871 17:77364789-77364811 CCTGGGGCTGCTGGCTGAGGTGG + Intronic
1152367561 17:79865419-79865441 CCTGGGTCTACTCTCTGAGTTGG + Intergenic
1152410004 17:80118364-80118386 CCTGGGGCTGCTCAGGCTGGTGG + Intergenic
1152563892 17:81091659-81091681 CCTGGGGCTGCTTTCTTGAGCGG + Intronic
1153920688 18:9786496-9786518 CTTGGGACTGGTGTCTGTGGAGG + Intronic
1153942425 18:9989675-9989697 GCTGGGGCTCCTCCCTGGGGAGG + Intergenic
1155169919 18:23259827-23259849 GCTGAAGCTGCCCTCTGTGGAGG - Exonic
1156540026 18:37900502-37900524 CCTCTGGATGCTGTCTGTGGAGG + Intergenic
1156870625 18:41941027-41941049 CCTGGGACTGCTCTTGGTGAAGG + Intergenic
1157978426 18:52352655-52352677 CCTGAGGGTCTTCTCTGTGGAGG + Intronic
1157981773 18:52390092-52390114 CCTGGGTCTTCTGTTTGTGGCGG - Intronic
1158352639 18:56578611-56578633 CCTGGTGCTGGTTTCTGTGCAGG - Intergenic
1160537019 18:79600175-79600197 GCTGGGGCTGGGCTCTGGGGAGG + Intergenic
1160594287 18:79963662-79963684 GATGGGCCTGCTCCCTGTGGTGG + Intergenic
1160765106 19:804151-804173 CCTGGGGCTGCCCTTTGGGAAGG + Exonic
1160782686 19:884854-884876 CCTGGGCCTGCCCTCGGGGGCGG - Intronic
1160939896 19:1615348-1615370 TCTGGGGCTTCTCGCTGTTGAGG + Exonic
1161300350 19:3539424-3539446 CCAGTGGCCGCTCACTGTGGGGG + Intronic
1161380978 19:3964756-3964778 CCTGGAGCTGGTCTCTGGCGGGG - Exonic
1161628838 19:5341105-5341127 CCTGGGGCTACTGTCCGTGCGGG + Intergenic
1162079082 19:8208435-8208457 CCTGGGGCTGTCCTCTGTTCAGG + Intronic
1162490280 19:10987442-10987464 CCTGGGGCTGGCCCCAGTGGAGG + Intronic
1162789499 19:13055600-13055622 CCTGAGGCTGCTCCAAGTGGAGG - Intronic
1162821892 19:13228249-13228271 GCTGAGGCTGGTCTCTGAGGGGG + Intronic
1163230932 19:16001748-16001770 CTTGGGGCTTCTCTGTGTAGGGG + Intergenic
1163774161 19:19208247-19208269 CCAGGGGCTGCTGCCAGTGGGGG - Intergenic
1163785131 19:19271070-19271092 CCTGGGTCTGCTTTTCGTGGCGG - Exonic
1163794210 19:19327096-19327118 CCTGGGGAGGCTGTGTGTGGTGG - Intronic
1164589720 19:29500068-29500090 GCTGGGGCTGCCCTGTGTGTTGG - Intergenic
1165051207 19:33142670-33142692 CCCGGGACTGCTGTCTGTGTTGG - Intronic
1165067176 19:33236019-33236041 CGTGGGGCTGCGCGCTGCGGCGG + Intergenic
1165463745 19:35959801-35959823 CACGGTGCTGCGCTCTGTGGTGG + Intergenic
1167506643 19:49874334-49874356 GCTGGCGCTGCTCTCTGTGCTGG + Intronic
1167607054 19:50487053-50487075 CCTGTGGCTTCTCTCAATGGAGG + Exonic
1167621307 19:50562533-50562555 CCTGGGGCTGGCCTCTGCAGTGG + Intronic
1167732158 19:51266156-51266178 CCCCGGGGTGCTGTCTGTGGTGG + Intronic
1202695237 1_KI270712v1_random:118532-118554 CCAGCAGCTGCTCTCTGTGATGG - Intergenic
925132422 2:1503247-1503269 CCAGGAGCTGCTCTGTCTGGAGG - Intronic
926038759 2:9655893-9655915 CCTGGGGCTGCAGACTGTGGTGG - Intergenic
926109157 2:10171048-10171070 GCTGGGTCTGCTCAGTGTGGAGG - Intronic
927948643 2:27152746-27152768 GCTGGGGGTGCTGGCTGTGGTGG - Exonic
929460375 2:42098846-42098868 CCTAGGCCTGCTCCTTGTGGAGG + Intergenic
930013675 2:46956509-46956531 CCTGGGGCTGCAGTCTTTGGGGG + Intronic
930085432 2:47494051-47494073 CCTGGCGTTGCTCTCAGTGAGGG - Intronic
930883620 2:56299466-56299488 CCTGAGGCTGCACTCTGTTCTGG + Intronic
931582911 2:63796647-63796669 GCTGGGGCTGCTCCCTCTGTGGG - Intronic
931755590 2:65371268-65371290 CCTGGGACTGGTCTCTGGGAGGG + Intronic
932037833 2:68265359-68265381 TCTGGGTCTGTTCTTTGTGGAGG - Intergenic
932290281 2:70571203-70571225 ACAGGGGCTGGCCTCTGTGGAGG - Intergenic
932625316 2:73292275-73292297 CTGGGAGCTGCTTTCTGTGGGGG - Exonic
933180400 2:79220434-79220456 CCTGGAGCTGCTCGTTGAGGTGG - Intronic
934276405 2:91575581-91575603 CCAGCAGCTGCTCTCTGTGATGG - Intergenic
934555535 2:95285231-95285253 CCTGGGGCCTCTTCCTGTGGAGG + Intronic
935656589 2:105428662-105428684 CCTGGAGCTTCTATCTGTTGTGG + Intronic
936283538 2:111163103-111163125 GCTGCGGCTGGTGTCTGTGGGGG + Intronic
937338113 2:121074525-121074547 CCTGGAGCTACTCCCGGTGGTGG + Intergenic
937341755 2:121095774-121095796 CCTGGGGCTGCCCCCCGTGAAGG + Intergenic
937792779 2:125980059-125980081 CCTGGCCCTGCCCTCTGTGTGGG - Intergenic
937987600 2:127645462-127645484 CCTGGGGCTCCTCCCTGGGGTGG - Intronic
938140701 2:128792078-128792100 ACTGGAGATGCTCCCTGTGGGGG + Intergenic
940901508 2:159130459-159130481 ACTGTGGCTGCTTTATGTGGGGG + Intronic
941918796 2:170829155-170829177 CCTGGGGCTGGTCACTGGAGTGG + Intronic
942189919 2:173459101-173459123 CATGGCGCTGCTCTCTATGCTGG - Intergenic
942727544 2:179026591-179026613 GCTGGGGGTACTCTGTGTGGGGG - Intronic
944530706 2:200665135-200665157 TCTTGGGCTGGTCTCTCTGGAGG - Intronic
945721361 2:213421871-213421893 TCTGGGTCTCCTCTCTGTGGAGG + Intronic
947533082 2:230925014-230925036 CCTGGGACTGCTCGCTGAGTTGG + Intronic
948175684 2:235940794-235940816 CCTGAAGCCCCTCTCTGTGGTGG - Intronic
948407768 2:237735382-237735404 CCTGGGGATGCTCGCTGGGCAGG + Intronic
948439904 2:237979958-237979980 CCTGGTGGTGCTCTCTCTGGAGG + Intronic
948524456 2:238562015-238562037 CCAGGGGCTGATCGCTGTGAAGG - Intergenic
948673669 2:239584583-239584605 CCTGTGGCTGCTCTGTCAGGTGG + Exonic
948857250 2:240735845-240735867 CCGGGGGGTGTTCTATGTGGAGG - Intronic
948930663 2:241129808-241129830 CCTGGGGCTGCCCTGGGTTGAGG - Intronic
1171376919 20:24700059-24700081 CCTGTGGCTTCTCTCCGTAGAGG + Intergenic
1171431934 20:25088395-25088417 CCTGTGGTTGCTGTCTGGGGTGG + Intergenic
1172103058 20:32497266-32497288 CCTGGAGCTGCTCTTTGCTGGGG + Intronic
1172883268 20:38215313-38215335 CCTGGGGATGGCCTGTGTGGAGG - Intronic
1173810095 20:45950204-45950226 CCAGGGGCAGCTCACTGTGCAGG + Exonic
1174195190 20:48767827-48767849 TCAGGGGAGGCTCTCTGTGGAGG - Intronic
1174767246 20:53265659-53265681 TCTGTGGCTGCTCCTTGTGGGGG + Intronic
1175324824 20:58116317-58116339 CCTGGGGCTGCAATCTTAGGGGG + Intergenic
1175391456 20:58630179-58630201 CATAAGGCTGCTCTCTGAGGAGG - Intergenic
1176064295 20:63186848-63186870 CCTCAGGCTGCTATCTGGGGAGG - Intergenic
1176385807 21:6138103-6138125 CCTGGCAATGCTTTCTGTGGGGG + Intergenic
1178027949 21:28489483-28489505 CCTCGAGCTGCTCTCTTTGTTGG + Intergenic
1178584401 21:33860368-33860390 CCTTGGGCAGCTATCAGTGGGGG + Intronic
1179437771 21:41374038-41374060 TGTGGCGCTGGTCTCTGTGGAGG - Intronic
1179617893 21:42593592-42593614 CCTGGGGCTGCACTCAGTCCTGG + Intergenic
1179737666 21:43400149-43400171 CCTGGCAATGCTTTCTGTGGGGG - Intergenic
1180083839 21:45498539-45498561 GCTGGGGCTGCACTCTGGGGTGG + Intronic
1180739786 22:18045100-18045122 CCTGGGGTTTCACTCTGAGGAGG - Intergenic
1180968727 22:19803818-19803840 CCTCAGGCAGCGCTCTGTGGTGG + Intronic
1182409391 22:30170303-30170325 CCTGGGGCTGCCCTCTCCCGTGG + Intronic
1183265629 22:36823552-36823574 CCTGTGGCCGCTCTCTCCGGAGG - Intergenic
1183350449 22:37331864-37331886 GCTGGGGGTGCTGTATGTGGTGG - Intergenic
1183464936 22:37974923-37974945 CCTGGGCCTGCTCCCTGTCCTGG + Intronic
1183696542 22:39426904-39426926 CCTGGGGCTGGGCTCGGTGTGGG - Exonic
1184250583 22:43258031-43258053 CCTGGGGAGGCTTTCTGGGGAGG - Intronic
1184659605 22:45959832-45959854 ACCGGGGCAGCTCTCCGTGGGGG + Intronic
950525932 3:13523260-13523282 CCTGGGGCTGACCACTGTGTGGG - Intergenic
950543268 3:13624843-13624865 CCTGGTGCTGCACCTTGTGGCGG - Intronic
950655387 3:14433210-14433232 CCTGGGGCAATTCTCTCTGGGGG - Intronic
950740830 3:15050615-15050637 CATGGGAGGGCTCTCTGTGGAGG + Exonic
953133959 3:40166952-40166974 CCTCCTGCTCCTCTCTGTGGGGG + Intronic
953589473 3:44237707-44237729 GCTGGAGGGGCTCTCTGTGGGGG - Intergenic
954596384 3:51829265-51829287 CCTTGGGCAACTCTCTGTTGAGG - Exonic
955042874 3:55334071-55334093 CCTTGCTTTGCTCTCTGTGGGGG - Intergenic
956468399 3:69541446-69541468 CCTGCGGCTGCTTTCTCAGGCGG + Intronic
958256599 3:91332363-91332385 CCTGAGGCTGCTTTCAGGGGTGG - Intergenic
959039392 3:101403486-101403508 CCTGGGCCTGTTATCTTTGGGGG + Intronic
959862284 3:111229816-111229838 CCAGTGGCAGCTCTGTGTGGGGG - Intronic
960345167 3:116521758-116521780 ACTGGTCCTGCTCTCTGGGGTGG - Intronic
960500942 3:118437473-118437495 CCTGGGGTTGGGCCCTGTGGTGG + Intergenic
961332688 3:126152248-126152270 CCTGGGGCTGCTCCCAGGGTGGG - Intronic
961513542 3:127419257-127419279 CAAGAGGCTGATCTCTGTGGGGG + Intergenic
961558564 3:127713325-127713347 CATGGGGCTGCCAGCTGTGGCGG + Intronic
961819734 3:129569843-129569865 CCTGCTGCTGCTCTCCGTGGTGG - Exonic
962343306 3:134602658-134602680 CCTCTGGAGGCTCTCTGTGGAGG + Intronic
964086679 3:152827327-152827349 CCTGGGGCTGGTTTTTGTGATGG + Intergenic
968433645 4:574549-574571 CCTGGGGCTGCTCTGCCTGGTGG - Intergenic
968486884 4:867157-867179 CCTGGGCCTGCACTCCGAGGTGG - Exonic
968666278 4:1823974-1823996 CCTTGGGGTCCTCGCTGTGGGGG - Intronic
968901677 4:3435056-3435078 CCTGGGGCAGCTCACTGGGCGGG + Intronic
968909605 4:3470950-3470972 CCTGTGGCTCTGCTCTGTGGTGG - Intronic
968922196 4:3528061-3528083 GCTGGGGCTGCTTTTTGTGGTGG - Intronic
969442854 4:7227590-7227612 CCTGGCGCCCCTCTGTGTGGTGG + Intronic
969508899 4:7605909-7605931 CCAGGTGGTGGTCTCTGTGGAGG + Intronic
976051945 4:81019975-81019997 TCTGGGGATGGTCTCTATGGTGG - Intergenic
977667468 4:99657420-99657442 ACTAGGGCTGTGCTCTGTGGAGG - Intergenic
979956183 4:126956109-126956131 TCTGGGTCTGCTCTCTGCGGAGG + Intergenic
982083522 4:151812835-151812857 CCTGGGGCAGCTCTTTGTACAGG + Intergenic
982717820 4:158827328-158827350 ACTGGGGCTGCTCATAGTGGTGG + Intronic
984648682 4:182246230-182246252 CTTGGGGCTGCTGGCAGTGGTGG - Intronic
985643709 5:1075284-1075306 CCTGGGGCAGCTCCCTGGAGGGG - Intronic
988331586 5:29848711-29848733 CTTGGAGCTGCTATCTGTGCTGG + Intergenic
990118486 5:52419405-52419427 TCTGGGGCAGTTCTCTGTGATGG + Intergenic
990622878 5:57579185-57579207 CCTGAGGAGGCTCTCTGTGAAGG + Intergenic
991528596 5:67591504-67591526 ACTTGGGCTGCTCTCTTTGGGGG - Intergenic
992160678 5:73997854-73997876 GCTGGGGCCGCTGTCTGTGTGGG - Intergenic
992569679 5:78042596-78042618 CCTTGAGCTGTTCTCTGAGGTGG - Intronic
992883093 5:81130156-81130178 CCTGGTGGTGCTTTCTGAGGAGG + Intronic
996605011 5:125311645-125311667 CCTGGGGCTGCAGTCACTGGGGG - Intergenic
996727708 5:126687100-126687122 CCTAGGGCTGCCCTCTGGGAAGG + Intergenic
997246999 5:132358118-132358140 CCTGGGGCTTAGCCCTGTGGAGG + Intergenic
998340150 5:141410056-141410078 CCTGGGGCTGCGCACTGGGGAGG + Exonic
999561322 5:152806596-152806618 ACTGTGGCTGCTCTTTGTTGTGG - Intergenic
999572396 5:152934666-152934688 CCTGGTTCTTCCCTCTGTGGGGG - Intergenic
999687332 5:154114893-154114915 TCTGGGCCAGCTCTCTGGGGAGG - Intronic
1000415545 5:160980341-160980363 CTTGGGGCTGCTCTGTGTGTGGG + Intergenic
1000819088 5:165960966-165960988 CCTGGGGATGCTTTCTGTCCTGG - Intergenic
1001398711 5:171434140-171434162 CCTGGGGCTGCCCGCAGGGGTGG + Intronic
1001524335 5:172418054-172418076 TCTGGGGCTCCTCTCTCTAGTGG - Intronic
1005997185 6:30938632-30938654 CCTGAGGGGGCTCCCTGTGGAGG - Intergenic
1007581408 6:42962397-42962419 CCTGGGGCTCCTTTAAGTGGGGG + Intronic
1007785476 6:44276967-44276989 CCTGGGGCCTCTCTCTATGGAGG + Exonic
1007901713 6:45419934-45419956 CTTGGGGCTAGTGTCTGTGGAGG + Intronic
1008998742 6:57688797-57688819 CCTGAGGCTGCTTTCAGGGGTGG + Intergenic
1009187226 6:60588176-60588198 CCTGAGGCTGCTTTCAGGGGTGG + Intergenic
1010258553 6:73789185-73789207 CCTAGGGCAGTTCTCTGTGCAGG + Intronic
1011344656 6:86355521-86355543 CCTGGGTCTACCCTCTGTGATGG - Intergenic
1012944162 6:105448315-105448337 GCTGGGGAGGCTCTCTGAGGAGG - Intergenic
1013227896 6:108133897-108133919 GCTGGGGCAGCTCCGTGTGGGGG - Intronic
1013422624 6:109979706-109979728 CCTGGGGCTGCTGCCCGTGCTGG + Exonic
1013737952 6:113249100-113249122 CCTGTGGCTGCTCAGGGTGGGGG - Intergenic
1016438173 6:144058988-144059010 CCTGGGGGTACTCTGTGTGGTGG + Intronic
1018060984 6:160089597-160089619 ACTGGGGCTGCTCTTGGGGGTGG + Intronic
1018908130 6:168086947-168086969 TCGGGGACTGCTCTCTGAGGCGG - Intergenic
1018923604 6:168192102-168192124 CCTGGGGCTGATGACTTTGGGGG + Intergenic
1019603826 7:1898672-1898694 CCGAGGGCTGATCCCTGTGGAGG - Intronic
1019837221 7:3400105-3400127 ACTGGGTCTGCTCCCTCTGGTGG + Intronic
1020280764 7:6648914-6648936 CCTGGTGCTGATGCCTGTGGAGG + Intronic
1022443959 7:30455029-30455051 CCTGGGCCTGCTTCCTGAGGTGG + Intronic
1023028686 7:36074531-36074553 CCAGGGGCAGTCCTCTGTGGAGG + Intergenic
1023502952 7:40870223-40870245 CATGGCTGTGCTCTCTGTGGGGG + Intergenic
1024212684 7:47219074-47219096 CTTGGGGCTGCGCTCTGAGCTGG - Intergenic
1026704978 7:72682787-72682809 GTTGGCGCTGGTCTCTGTGGAGG - Intronic
1026853273 7:73737832-73737854 CCTGGGGATACACCCTGTGGAGG + Intronic
1027139761 7:75648766-75648788 CCAGGGTCTGCTCTCTGGGCAGG - Intronic
1029579278 7:101424705-101424727 CTTGGGGCTGCTGTCTGGGCAGG + Intronic
1029746050 7:102516395-102516417 ACTGGCACTGCTCTCGGTGGTGG + Intronic
1029763988 7:102615374-102615396 ACTGGCACTGCTCTCGGTGGTGG + Intronic
1030923387 7:115420590-115420612 CCTGGTACTGGTTTCTGTGGAGG + Intergenic
1031381655 7:121093573-121093595 CCTGTGGATGCAGTCTGTGGAGG - Intronic
1034154827 7:148948112-148948134 CTTGGGTCTGCTCTCTGTTCTGG + Intergenic
1035076412 7:156180618-156180640 CCTGAGGCTGCTCACTGCAGAGG - Intergenic
1035243657 7:157548550-157548572 CCGGGGCCTGCGCTTTGTGGAGG - Intronic
1035354685 7:158270086-158270108 GGAGGGGCTGCTCACTGTGGAGG + Intronic
1036034452 8:5003973-5003995 CCTGGGCCTGCTCCCTGGGGAGG - Intergenic
1037169067 8:15868168-15868190 CCTGTGGCAGCTCTCTGGAGAGG + Intergenic
1037540093 8:19862582-19862604 CCTGGGGGGGCTGTCTGTGGGGG - Intergenic
1037931651 8:22884177-22884199 CCTGTGTCTGCTCTCTGTGTGGG - Intronic
1038035584 8:23683248-23683270 CCAGGAGCTTCTCTCTGTTGCGG - Intergenic
1038611966 8:29066674-29066696 CCTGGCCCTGCTCTCTGATGAGG - Intergenic
1038717084 8:30000679-30000701 CCTCAGGCAGCTCTCTATGGAGG - Intergenic
1042803576 8:72747125-72747147 CCTGGGGCTTCCCTTTGTGGTGG - Intronic
1044728150 8:95209387-95209409 CCTGGGGCTGCTCCCTCCTGAGG + Intergenic
1044915380 8:97107736-97107758 CCAAGGGCAGCTCTCTGAGGTGG + Intronic
1046561548 8:115843887-115843909 TCTTGTGCTGCTCTCAGTGGTGG - Intergenic
1047422613 8:124719460-124719482 TCTTGGGCTGATCTCTATGGTGG + Intronic
1048306829 8:133290273-133290295 CCTGTGGCTGCTCTTCCTGGTGG - Intronic
1048693502 8:136995703-136995725 CCTGGGGCCGCTCTCTCTCTTGG - Intergenic
1048860990 8:138724447-138724469 GCTGGGTCTTCTTTCTGTGGTGG - Intronic
1049284340 8:141766495-141766517 CCTGGGGCATGGCTCTGTGGGGG + Intergenic
1049329986 8:142045382-142045404 GCTGGGGAGGGTCTCTGTGGAGG - Intergenic
1049336894 8:142091429-142091451 CCTGGCACTGCTCTCTGGGATGG + Intergenic
1049337379 8:142093643-142093665 CCTCAGGCTCCTGTCTGTGGAGG - Intergenic
1049664536 8:143837110-143837132 CCTGGGGCTGCCCCGTGTGCTGG - Exonic
1049812313 8:144580983-144581005 CCCGGGGCTGCTCTCCGCCGAGG + Exonic
1050388378 9:5112624-5112646 TCTGGGGCTTCTCGCTGTTGAGG - Intronic
1052062460 9:23977471-23977493 TCTGTGGGTTCTCTCTGTGGTGG + Intergenic
1052745095 9:32432878-32432900 TCTGGGGCTGCAGTCTCTGGAGG + Intronic
1053153287 9:35756544-35756566 CCTGGGCCTGCTCTCTGGGCTGG + Exonic
1055856235 9:80691679-80691701 CCTGTGGGTACTCTGTGTGGGGG - Intergenic
1056260398 9:84842635-84842657 CCTGGGGCTGATTTCAGTGATGG + Intronic
1056818104 9:89816327-89816349 CAAGCTGCTGCTCTCTGTGGTGG + Intergenic
1057073741 9:92123030-92123052 CTTGGGCCTGCTCACTGGGGTGG - Intergenic
1057134923 9:92680726-92680748 CTTAGGGCTGCTCCCTGGGGAGG + Intergenic
1057271986 9:93656626-93656648 CCTGGGGCTCTTGGCTGTGGGGG + Intronic
1057551704 9:96055940-96055962 CCTGTGGCTGTGCTCTGTGGTGG - Intergenic
1057623254 9:96655191-96655213 CCAGGGGCTGCCCGCTGTCGGGG + Exonic
1058456606 9:105143536-105143558 CCTGGGGATGCACACTGTCGTGG - Intergenic
1058700225 9:107594191-107594213 CCTGGGTCTGATCTTTGTGGAGG + Intergenic
1060575107 9:124684627-124684649 CCCCTGGCTGCTCTCTGGGGAGG - Intronic
1060815960 9:126635269-126635291 CCCGGGCCTGCTCCCTGTGTGGG - Intronic
1061757465 9:132825017-132825039 CTTTGGGCTTCTCTCAGTGGAGG - Intronic
1062024088 9:134332500-134332522 CCTGGTCCTGCTGCCTGTGGAGG + Intronic
1062108127 9:134766830-134766852 CCTGGGGCTGCTCTCTGTGGTGG + Intronic
1062158120 9:135065415-135065437 CCTGGACCTGGGCTCTGTGGAGG + Intergenic
1062214926 9:135384071-135384093 CCTTGGGCTGCCCTCTCTGGTGG - Intergenic
1062324439 9:136005400-136005422 CCTGGGGCTGGGCTTGGTGGTGG + Intergenic
1062354922 9:136157412-136157434 CCTGGGCCTGCTCGTGGTGGGGG + Intergenic
1062480573 9:136749044-136749066 TCTGGGGGTGCTGGCTGTGGGGG - Intergenic
1186189776 X:7057106-7057128 CCTGGGGATGGTCTCTGTCCAGG + Intronic
1186211245 X:7252782-7252804 CCTGGGGCAGCTCTTTGTGCTGG - Intronic
1186459640 X:9738019-9738041 CTGGAGGCTGCTCTCTGTGAGGG - Intronic
1187115574 X:16346848-16346870 CCTGGCACTGGTCCCTGTGGCGG + Intergenic
1190094508 X:47467735-47467757 CCAGGGGCCGCTCACTGTGCTGG + Exonic
1190743403 X:53305836-53305858 CTTTGGGCTGCACTGTGTGGTGG - Intronic
1191253252 X:58269197-58269219 CTTTGGGGTGCTCCCTGTGGGGG + Intergenic
1191846627 X:65551839-65551861 CCTGCGGCTGCTCTATGAGGAGG - Intergenic
1193040217 X:76996920-76996942 CCTGGGGCTGCTCTGAGTGTGGG + Intergenic
1197902899 X:131392841-131392863 CCTGGTGCTGCTCTGGGTGGTGG - Intronic
1198566089 X:137906902-137906924 CCAGTGGGTACTCTCTGTGGCGG - Intergenic
1198872321 X:141188777-141188799 CCTGGGGCTGCTCCGAGTGCGGG + Intergenic
1199223468 X:145343834-145343856 CCTGTGGCTGCTCTCAAGGGTGG + Intergenic
1199764864 X:150934153-150934175 CCTTGAGCTGCTGTCTGTGTAGG - Intergenic
1200024486 X:153245194-153245216 CCTGGGGCTGAACACTGTGGAGG - Intergenic
1200236996 X:154472550-154472572 CCTGGAGCTGGGCTCTGTAGGGG - Intronic
1200699792 Y:6392391-6392413 CCTGGGGTTGCTCTCTGCCAGGG - Intergenic
1200913229 Y:8549255-8549277 CCTGGGGTTGCTCTCTGCCGGGG + Intergenic
1200976386 Y:9216015-9216037 CATGGGGGTGCTGGCTGTGGGGG + Intergenic
1201034319 Y:9772307-9772329 CCTGGGGTTGCTCTCTGCCAGGG + Intergenic
1201152855 Y:11103246-11103268 CCTGGCGATGCTCTCCGTGTGGG - Intergenic
1201584595 Y:15546772-15546794 CCTGGGGCAGCTCTTTGTGCTGG - Intergenic
1202134784 Y:21650515-21650537 CATGGGGGTGCTGGCTGTGGGGG - Intergenic