ID: 1062108567

View in Genome Browser
Species Human (GRCh38)
Location 9:134769259-134769281
Sequence GGGCCAACTGACTCGGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062108567_1062108576 29 Left 1062108567 9:134769259-134769281 CCTCAGGCCGAGTCAGTTGGCCC 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1062108576 9:134769311-134769333 CTTGGTCAGAAGAAGCAGAGTGG No data
1062108567_1062108573 11 Left 1062108567 9:134769259-134769281 CCTCAGGCCGAGTCAGTTGGCCC 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1062108573 9:134769293-134769315 CATCACAAACTGCCCTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062108567 Original CRISPR GGGCCAACTGACTCGGCCTG AGG (reversed) Intronic
902564683 1:17303625-17303647 TGGCCAAGTGACCTGGCCTGGGG + Intergenic
903971541 1:27122200-27122222 GGGGCACCTGACTCAGCCTGGGG - Intronic
905133191 1:35777119-35777141 GGGACAACTGACTGTGCCTGGGG + Intergenic
914645330 1:149647144-149647166 CGGGCAACTGACACGGCCTCCGG + Intergenic
919777948 1:201206322-201206344 GGGACAGCTGACTCAGCCTGGGG + Exonic
920949929 1:210563141-210563163 GGGTCAAGTGATTCCGCCTGTGG + Intronic
921174654 1:212583603-212583625 GGGCCAACTGACAGGGGCTGTGG + Intronic
1068045670 10:51883107-51883129 GGGCAAACTGTCTCTTCCTGAGG + Intronic
1070260513 10:74850176-74850198 GATCCACCTGCCTCGGCCTGTGG + Intronic
1075654240 10:124150941-124150963 GGCCCAGCTGCCTCGGCTTGGGG - Intergenic
1077433457 11:2527128-2527150 GGGCCAACGTTCTGGGCCTGTGG - Intronic
1078617853 11:12881742-12881764 GGAACAACTGCCTCTGCCTGGGG + Intronic
1079349104 11:19677730-19677752 TGGCCAGCTGATTTGGCCTGGGG - Intronic
1080884763 11:36356534-36356556 GGGCCAATTGACTTGGCCAGAGG - Intronic
1084206921 11:67600473-67600495 GGGCCAACTGGCGGGGACTGTGG + Intergenic
1084329416 11:68421872-68421894 GGTCCAAGAGACTGGGCCTGGGG + Intronic
1089329649 11:117680552-117680574 GGGAGAACTGACTCAGGCTGGGG + Intronic
1090615729 11:128512869-128512891 CAGCCCACAGACTCGGCCTGCGG + Intronic
1092299389 12:7231040-7231062 GGGACATCTAACTTGGCCTGGGG + Intergenic
1098299819 12:69042959-69042981 GGGCCCTCTGACTCTGCCTCTGG - Intergenic
1101803544 12:108043610-108043632 GGGCTTACTGACACAGCCTGGGG + Intergenic
1102527424 12:113521696-113521718 GGGTGACCTGACCCGGCCTGGGG - Intergenic
1103614029 12:122141073-122141095 TGCCCCACTCACTCGGCCTGAGG - Exonic
1104058712 12:125250060-125250082 GAGCCAACTGACTCAGTCAGGGG - Intronic
1106057866 13:26254814-26254836 GGGCTACCTGCCTCGGCCTGCGG - Intronic
1121342735 14:93115205-93115227 CGGCCGCCAGACTCGGCCTGTGG - Exonic
1122194744 14:100076559-100076581 GGACCATCTAACTCAGCCTGGGG + Intronic
1127083106 15:55399807-55399829 GAGCCAACGGGCCCGGCCTGTGG - Intronic
1130263819 15:82380669-82380691 GGGACAACTGCCTCTGCTTGAGG + Intergenic
1130469797 15:84216167-84216189 GGGACAACTGCCTCTGCTTGAGG - Intergenic
1130477285 15:84330730-84330752 GGGACAACTGCCTCTGCTTGAGG - Intergenic
1130494480 15:84457400-84457422 GGGACAACTGCCTCTGCTTGAGG + Intergenic
1130592086 15:85220791-85220813 GGGACAACTGCCTCTGCTTGAGG - Intergenic
1132145146 15:99425151-99425173 GGGCCAAGTGGCGCGGTCTGTGG - Intergenic
1132329066 15:100998387-100998409 GGGGCAAGTGACCAGGCCTGAGG - Intronic
1144207768 17:12991095-12991117 TGGCCCACGGGCTCGGCCTGCGG + Exonic
1151894730 17:76972310-76972332 GAGCCATCTGACCCAGCCTGGGG - Intergenic
1152133470 17:78490981-78491003 GGGCCAAGGGACTAGGGCTGTGG - Intronic
1152288099 17:79424015-79424037 GGGGCTCCTGACTCGGACTGAGG - Intronic
1156746851 18:40402817-40402839 GTGCTCACTGACTCCGCCTGAGG + Intergenic
1157602748 18:48904180-48904202 GGGCCAGCTGAGGTGGCCTGTGG + Intergenic
1161395409 19:4042747-4042769 GGGCCACCTGACTCTGCTAGAGG - Intergenic
1161532668 19:4799541-4799563 GTGCCAATTGGCTTGGCCTGAGG + Exonic
1165852464 19:38857686-38857708 GGGCCCACTGAGACGGGCTGAGG + Intergenic
926845185 2:17129080-17129102 GGGCCACTTGACTAGGCCTCAGG - Intergenic
927030775 2:19118492-19118514 GGGCCAGCAGATTCAGCCTGTGG - Intergenic
927452516 2:23221262-23221284 GGGCAGACAGTCTCGGCCTGGGG - Intergenic
932463069 2:71895828-71895850 GGGCCAGTTGTCTCAGCCTGGGG + Intergenic
949046966 2:241876769-241876791 GGGCCCTCTGAGTCGGCGTGTGG - Intergenic
1169642821 20:7774110-7774132 AGGCCAACTGGCTCTGCCTGGGG - Intergenic
1171197777 20:23214575-23214597 GGCCCAACTGAAGCGGCCTCTGG + Intergenic
1173193119 20:40891556-40891578 TGACCAACTCACTGGGCCTGAGG - Intergenic
1174200073 20:48800938-48800960 GGGCCACCGCACTCAGCCTGTGG + Intronic
1174351025 20:49968095-49968117 GAGCCACCTCACCCGGCCTGGGG + Intergenic
1176075719 20:63247471-63247493 GGGCCAGCTGACCTGGCCTCAGG - Intronic
1178799272 21:35777286-35777308 GGGTGACCTGACTCAGCCTGGGG - Intronic
1179476475 21:41649709-41649731 AGGCTGACGGACTCGGCCTGGGG - Intergenic
1179626432 21:42652234-42652256 GGGCCAGCTGACTCGCCATGGGG - Intergenic
1180098859 21:45574953-45574975 GTGCCCACTGCCTCTGCCTGGGG - Intergenic
1181002162 22:19992896-19992918 GGGCCCACTGGCTCTGGCTGAGG + Intronic
1181055026 22:20256772-20256794 GGGCCATGTGACTGGGCCTGGGG - Intronic
1182357567 22:29729239-29729261 GGGCCCAGTGACTTGGCCAGGGG + Intronic
1183417605 22:37691474-37691496 GGGCCAGCTGCCTTTGCCTGGGG + Exonic
1183434400 22:37785056-37785078 GGTGCAACTAACTCGGCCAGAGG + Intergenic
1184692593 22:46123974-46123996 GGGCCGTCTCACTGGGCCTGGGG + Intergenic
1185411932 22:50687241-50687263 GGTTCAACTGACACAGCCTGGGG - Intergenic
952159182 3:30676636-30676658 GTGCCAACTGAATCTGCCTTGGG - Intronic
953143371 3:40249901-40249923 GGGCCACCTGGCTCAGCATGGGG - Intronic
954511684 3:51131180-51131202 GGGTCATCTGACTGAGCCTGTGG - Intronic
954784129 3:53080838-53080860 GGGTCCAGTGACTAGGCCTGGGG + Intronic
955056163 3:55457757-55457779 AGGCCAACTGACTCGGGGTCAGG + Intergenic
955651737 3:61202211-61202233 TGGCCAACTGACTGGGAGTGAGG + Intronic
966683155 3:182664817-182664839 GAGCCACCGCACTCGGCCTGAGG + Intergenic
967267309 3:187702005-187702027 GGGCCAGCTCACTGGGCTTGAGG + Exonic
967894731 3:194386599-194386621 GGAACAACTAACTCGGGCTGTGG + Intergenic
968451092 4:676384-676406 GGGCAAACACACACGGCCTGGGG + Intronic
975612783 4:76218041-76218063 GAGCCACCTGGCCCGGCCTGTGG - Intronic
975783220 4:77861110-77861132 GGGCCAACTGACCCCAGCTGTGG + Intergenic
981056991 4:140373653-140373675 GGTCCAAGTGTCCCGGCCTGAGG + Exonic
994251574 5:97542273-97542295 GGGCCAGCTCCCTCAGCCTGCGG - Intergenic
999262580 5:150246899-150246921 GGGCCCTCTGACTGGGGCTGGGG - Intronic
1001031482 5:168266451-168266473 GGGGGATCTCACTCGGCCTGTGG + Intergenic
1001594057 5:172886402-172886424 GGGGTACCTGACTTGGCCTGGGG - Intronic
1009975717 6:70668343-70668365 GGGGCCACTGACAGGGCCTGCGG - Intronic
1010018346 6:71130493-71130515 GGGCCAGCTGACTCTCCCTTTGG - Intergenic
1015980987 6:138838471-138838493 GGGCCAGCTGACTTGGGCAGCGG - Exonic
1019320997 7:415214-415236 GGGCCAACTCACGGGGCCCGTGG + Intergenic
1019444564 7:1064690-1064712 GGGCCAGGTGACTCGGCCGAGGG - Intronic
1024036431 7:45510871-45510893 AGACAAACTGACTCAGCCTGGGG - Intergenic
1030123530 7:106133688-106133710 GCACCAACTTACTCTGCCTGGGG - Intergenic
1040554915 8:48469871-48469893 GGGACACCTGACCTGGCCTGGGG - Intergenic
1040847489 8:51859090-51859112 GTGCCAACTGGCTCGTGCTGAGG - Intronic
1056193553 9:84207436-84207458 GTTCCCACTGACTCGGCCTGAGG - Intergenic
1062108567 9:134769259-134769281 GGGCCAACTGACTCGGCCTGAGG - Intronic
1185495596 X:552568-552590 GAGCCACCGCACTCGGCCTGCGG + Intergenic
1190052126 X:47158241-47158263 TGGCCAACAGACTCAGCCTATGG - Intronic
1193200183 X:78680383-78680405 GGCCCAAATGACTTGGTCTGTGG + Intergenic
1194721167 X:97341667-97341689 GGGCCAAGGGACTGGGACTGGGG - Intronic
1200074067 X:153542630-153542652 GGGCCAGCTTCCTCGCCCTGTGG - Intronic