ID: 1062108568

View in Genome Browser
Species Human (GRCh38)
Location 9:134769266-134769288
Sequence AGTCACTGGGCCAACTGACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062108568_1062108573 4 Left 1062108568 9:134769266-134769288 CCGAGTCAGTTGGCCCAGTGACT 0: 1
1: 0
2: 2
3: 9
4: 109
Right 1062108573 9:134769293-134769315 CATCACAAACTGCCCTTTCTTGG No data
1062108568_1062108576 22 Left 1062108568 9:134769266-134769288 CCGAGTCAGTTGGCCCAGTGACT 0: 1
1: 0
2: 2
3: 9
4: 109
Right 1062108576 9:134769311-134769333 CTTGGTCAGAAGAAGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062108568 Original CRISPR AGTCACTGGGCCAACTGACT CGG (reversed) Intronic
905490963 1:38343457-38343479 TGTGACTGGGCCTACGGACTAGG + Intergenic
907249374 1:53127952-53127974 AGTCCCTGGGCCAGCAGTCTGGG - Intronic
908007883 1:59745367-59745389 AGTCACTAGGCCAACTGCTCTGG - Intronic
912702025 1:111885197-111885219 GGTTACTGGGACAACTAACTAGG - Intronic
914210511 1:145574444-145574466 TGTCACCTGGCCAACTCACTAGG - Intergenic
915143151 1:153779198-153779220 AGTCACTGTGCCAGGTGCCTAGG + Exonic
916569779 1:166014990-166015012 AGTCACTGGGCCTACAGATGTGG + Intergenic
923137429 1:231130709-231130731 AGTCACTGAGCCCCCAGACTGGG - Intergenic
923504093 1:234590879-234590901 AGGCACTGGTTCAACTGATTTGG + Intergenic
924897096 1:248351242-248351264 ACGCATTGGGCCAAATGACTGGG - Intergenic
1065315743 10:24462292-24462314 AATCACTGGGGCATCTCACTGGG - Intronic
1075442634 10:122492218-122492240 AGTCACTGGGCCCACGGACGCGG - Intronic
1077317378 11:1925494-1925516 AGTCCCTGGCCCTACTGCCTGGG - Intronic
1083895973 11:65619944-65619966 AGGCACTGGGCCACCGGGCTTGG - Intronic
1084690862 11:70725562-70725584 ACCCACTGGTCCAAGTGACTCGG - Intronic
1086154131 11:83647172-83647194 AGACTCTGGGGAAACTGACTTGG - Intronic
1089344442 11:117781832-117781854 AGTGGCAGGGCCACCTGACTCGG + Intronic
1093149699 12:15606351-15606373 AGGAATTGGGCCAACTGCCTGGG + Intergenic
1102079867 12:110089379-110089401 CGTCACTGGGTCAACAGAATGGG - Intergenic
1105634630 13:22205117-22205139 GGTCAGTGGGCTTACTGACTAGG + Intergenic
1107081050 13:36375147-36375169 AGACACAGGGACAACTGAGTAGG + Intergenic
1109392929 13:61716777-61716799 AGTCACTGGGACCACTGTATGGG - Intergenic
1109685395 13:65813043-65813065 AGGCAAGGGGCCAACTGAGTTGG + Intergenic
1113800509 13:113083937-113083959 TGTCACTGGTCCACGTGACTCGG + Intronic
1115082139 14:29467647-29467669 AGTCACTGGACTAAGTGCCTGGG + Intergenic
1116062213 14:39938118-39938140 AGTGACTGGGTTAAGTGACTGGG + Intergenic
1118035374 14:61860667-61860689 AGGCACTGGGCCAAGAGAATGGG + Intergenic
1119585660 14:75832500-75832522 AGCCACAGGTCCACCTGACTTGG + Intronic
1125198790 15:37079930-37079952 AGTTACTGGGCCAACTGTCTCGG + Intronic
1125387111 15:39149640-39149662 AGTCACTGTGTCAGCTGCCTCGG + Intergenic
1126530875 15:49710451-49710473 AGGCACTATGCCAGCTGACTTGG - Intergenic
1129472377 15:75762839-75762861 AGACAAAGGGCCAACTGAGTTGG - Intergenic
1131848524 15:96513540-96513562 AGTGTCTGGGCCACCTGGCTTGG + Intergenic
1132179982 15:99744973-99744995 AGTCTCTGGGCCAGGTGAGTTGG + Intergenic
1133571170 16:7041753-7041775 AAGCACTGGGTCAAATGACTTGG - Intronic
1134413083 16:14019659-14019681 ACTCACTGGGCCAACTCACCTGG - Intergenic
1135064320 16:19296489-19296511 AGTTACTGGGTCAACTGATTGGG - Intronic
1135701882 16:24639942-24639964 AGTGACTGGGCCAAGTGCCATGG - Intergenic
1135936131 16:26781772-26781794 AGCCACTGGGCAAAGTGACCTGG - Intergenic
1138171274 16:54851771-54851793 ACTCACAGGGAAAACTGACTGGG - Intergenic
1141586823 16:85039565-85039587 AGTAACTGGGACTACAGACTTGG + Intronic
1142645640 17:1312433-1312455 CCTCACTGGGTCAGCTGACTGGG + Intergenic
1144437722 17:15256355-15256377 AGCCACTGCGCCATGTGACTTGG - Intronic
1148757796 17:49983437-49983459 ACTCCCTGGGCCAACTGAGGAGG + Intergenic
1148793114 17:50184669-50184691 TGTCACCGGGGCAACTGCCTGGG - Exonic
1149526784 17:57362478-57362500 ACTCACTGGGCAAACAGAATTGG - Intronic
1153061138 18:996172-996194 AATCACTGGGCCAAATGGGTTGG + Intergenic
1153339784 18:3961721-3961743 GGCCTCAGGGCCAACTGACTGGG + Intronic
1154258701 18:12809556-12809578 TGACACTGGCCCAAATGACTTGG + Intronic
1155530009 18:26757480-26757502 CGAGACTGAGCCAACTGACTTGG - Intergenic
1156109243 18:33703610-33703632 AATTACTGTGTCAACTGACTGGG + Intronic
1157687072 18:49651114-49651136 ACTCACTTGGTCAACTCACTTGG - Intergenic
1158052306 18:53237586-53237608 AGTCAGTGTGACAACTGACTAGG - Intronic
1158339593 18:56450953-56450975 AGTCACTGGGCCAGGGGAATGGG - Intergenic
1158633712 18:59138470-59138492 ATCCACTGGGCCAACTCACCTGG - Intergenic
1160016145 18:75142043-75142065 AGTCACTGGAACATATGACTTGG + Intergenic
1160731089 19:642162-642184 AGTCACTGGGACTCCGGACTGGG - Intronic
1164073181 19:21788207-21788229 AGGCACTGGGCCAAGACACTGGG + Intergenic
1167034481 19:46986150-46986172 AGTCACTGTGAAAACTGACATGG - Intronic
927236911 2:20882992-20883014 AGTCACTGGGCCCCATAACTTGG - Intergenic
927692705 2:25219576-25219598 AGCCAGTGGGGAAACTGACTTGG + Intergenic
930169852 2:48240183-48240205 GGTCACTAGGAAAACTGACTTGG - Intergenic
935116519 2:100142028-100142050 ACTCACTGGGGCCATTGACTGGG + Intronic
935132574 2:100271642-100271664 AGTGACTGTGTCCACTGACTGGG - Intergenic
939744720 2:145954380-145954402 AGTCACTGGGCCAAATGTGGTGG - Intergenic
940170947 2:150829617-150829639 AGTGTCTGGGCCAAGTGTCTGGG - Intergenic
947978346 2:234386889-234386911 ATTGATTGGGCCAACTGCCTGGG + Intergenic
948515881 2:238503689-238503711 AGCCACAGGGCCAGCTGCCTGGG - Intergenic
1171306744 20:24113120-24113142 AGTCACGGAGCCAAGTGTCTGGG - Intergenic
1172317671 20:33968834-33968856 AGTCACTGGCCCTACTGCCCAGG - Intergenic
1177611304 21:23452569-23452591 AGTCACCGGGCCACCGGACAGGG + Intergenic
1179952412 21:44716370-44716392 AGTCACTGAGTCAACTGACCAGG + Intergenic
1181313660 22:21958723-21958745 GGTCACTGGGGCCACCGACTTGG + Intronic
1183160829 22:36111825-36111847 AGTCCCTGGGACAAATGACCTGG - Intergenic
949800495 3:7898418-7898440 AGCCAGTGGGCTAACTGTCTGGG + Intergenic
952699234 3:36308016-36308038 AGTCTTTGGGTCAACTGGCTAGG + Intergenic
954220672 3:49151807-49151829 AGTCACAGGGCCAGCAGCCTGGG + Intergenic
955453389 3:59094618-59094640 AGTCAATTGGCCAACTGATGTGG - Intergenic
958691008 3:97466205-97466227 AGTTACCGGGCAAACAGACTTGG + Intronic
960142037 3:114160103-114160125 AATCACTGGACTAACTGACTTGG - Intronic
965453323 3:168866011-168866033 CATCACTGGGCAAACTGACCTGG + Intergenic
967213431 3:187189529-187189551 AGTCACTGGCACATCTGATTAGG + Intergenic
967327366 3:188254780-188254802 AATCACTGGGGCAACTGTATGGG + Intronic
968442908 4:633596-633618 AGCCACTGCGCCAGCTGAATGGG - Intronic
975452889 4:74550664-74550686 AGTCACCTGGACAACAGACTAGG + Intergenic
976470097 4:85418384-85418406 AATCACTGGACCAGCTGAGTTGG - Intergenic
980017301 4:127665635-127665657 AGTCACTGAGCCACATGACCAGG - Intronic
984710489 4:182880229-182880251 AGACACTGGGCCAAGTGACATGG - Intergenic
985069372 4:186152863-186152885 AGTCACTCAGCCAACGTACTGGG + Intronic
991476412 5:67025463-67025485 ACTCACTGGGTCCACTAACTTGG - Intronic
992611999 5:78515925-78515947 AGTCACTGGGCCCTGTGACCTGG - Intronic
997174233 5:131757534-131757556 AGTGACAGGGCCAAGTTACTAGG + Intronic
1002541830 5:179911330-179911352 TTTCCCTGGCCCAACTGACTTGG - Intergenic
1007692175 6:43709675-43709697 AGTGACTGGCCCAAAAGACTTGG + Intergenic
1014798670 6:125753417-125753439 TGTGACAGGGCCAACTCACTTGG - Intronic
1019285319 7:220322-220344 AGTCGCTGGGCCCACCCACTGGG + Intronic
1028340010 7:89706624-89706646 GTTCACTGGACCCACTGACTGGG - Intergenic
1030679732 7:112422326-112422348 AGTCACTGGGGAACCTGAATTGG - Intergenic
1032479704 7:132236501-132236523 AGACCCTGTGCCAAGTGACTCGG - Intronic
1034948228 7:155278011-155278033 AGACCCTGGGCCAACTTCCTCGG - Intergenic
1035256013 7:157628075-157628097 AGTCACTGGGTCACAAGACTGGG + Intronic
1036604795 8:10295445-10295467 GGTCACTGGGCCAGCAGTCTAGG - Intronic
1038682429 8:29681333-29681355 AGTCACTTGGCCAACAGTATGGG - Intergenic
1042427719 8:68668455-68668477 GGACACTGGGACAACTGACATGG + Intronic
1047532733 8:125692000-125692022 TGTCACCGGGCAAACTAACTTGG - Intergenic
1048878990 8:138857860-138857882 AGGCACTGGGCCAAGTGCCCGGG - Intronic
1051431571 9:16985279-16985301 AGGTCCTGGTCCAACTGACTGGG + Intergenic
1054836106 9:69675798-69675820 AGACACTGTGCCAAGTGACTTGG + Intergenic
1058806465 9:108597115-108597137 AGTGAGTTGGGCAACTGACTTGG - Intergenic
1059284018 9:113157458-113157480 CCTCACTGGACCAACTGGCTCGG - Intronic
1062108568 9:134769266-134769288 AGTCACTGGGCCAACTGACTCGG - Intronic
1062711892 9:137979499-137979521 AGTCACTGGGCCCAGTGACTGGG + Intronic
1189986379 X:46557260-46557282 AGTCAGTGTGCCAACAGAATTGG + Intergenic
1190160153 X:48026330-48026352 AATCACAGGGCCAACTCACGGGG - Intronic
1190958540 X:55221441-55221463 AATCACAGGTCCAACTGGCTGGG - Exonic
1192800676 X:74462087-74462109 AGACACTGGGCCAACAGAGGTGG - Intronic
1193934976 X:87607686-87607708 AGTCAAAGGGTAAACTGACTAGG - Intronic
1194045151 X:88992956-88992978 GGTAACTGGCCCAACTGGCTGGG + Intergenic
1198642199 X:138768771-138768793 AGTCTCTGGGCCAACAGCCTAGG + Intronic
1199198240 X:145057476-145057498 AGACACTGGGCCAACCCAGTGGG - Intergenic
1200114525 X:153764379-153764401 GGTCTCAGGGCCAACTGGCTGGG + Intronic