ID: 1062108569

View in Genome Browser
Species Human (GRCh38)
Location 9:134769279-134769301
Sequence TTTGTGATGTGGGAGTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062108569_1062108573 -9 Left 1062108569 9:134769279-134769301 CCCAGTGACTCCCACATCACAAA 0: 1
1: 0
2: 0
3: 23
4: 209
Right 1062108573 9:134769293-134769315 CATCACAAACTGCCCTTTCTTGG No data
1062108569_1062108576 9 Left 1062108569 9:134769279-134769301 CCCAGTGACTCCCACATCACAAA 0: 1
1: 0
2: 0
3: 23
4: 209
Right 1062108576 9:134769311-134769333 CTTGGTCAGAAGAAGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062108569 Original CRISPR TTTGTGATGTGGGAGTCACT GGG (reversed) Intronic
900960924 1:5919505-5919527 TCTGTGATGTGCCAGGCACTTGG - Intronic
901530116 1:9847540-9847562 TTTGTGTTGGGGGAGATACTGGG - Intergenic
903600406 1:24534300-24534322 ATTATGATGTCAGAGTCACTTGG + Intronic
906297239 1:44656354-44656376 TTAGTGATGTGGTAGTGACAAGG + Intronic
907107707 1:51899228-51899250 TTTGGGATGTGGGAGGAAATTGG + Intergenic
907679131 1:56547406-56547428 TTTGGGATGTGGGAGAGATTAGG - Intronic
908028963 1:59979842-59979864 TTTGTGAAGTTGGAACCACTTGG + Intergenic
910090634 1:83458966-83458988 TTTGTCATATGTCAGTCACTGGG - Intergenic
910367628 1:86483745-86483767 TTTGTTATGTGTCAGGCACTAGG + Intronic
910655198 1:89611052-89611074 TTTGTAGTATGGAAGTCACTGGG + Intergenic
911567202 1:99476211-99476233 TATGTGATGTGGCTTTCACTTGG - Intergenic
914886717 1:151591076-151591098 CTGGTGGTGTGAGAGTCACTGGG + Intergenic
916226289 1:162493036-162493058 TTTGTGATGTTGCAGCCACATGG - Intergenic
916996524 1:170307514-170307536 TTTGTGTTGGGGGAGTCCCAGGG + Intergenic
917626273 1:176849544-176849566 TGTCTGATGTGGTAGCCACTAGG + Intergenic
918494204 1:185115233-185115255 TTTGGGATGTGGGAGGAAGTTGG - Intergenic
918533921 1:185553328-185553350 TTTGAGATGGGGGTCTCACTAGG - Intergenic
922612837 1:226942626-226942648 CTTGTGATGTGGGAGGGGCTGGG + Intronic
924705734 1:246500498-246500520 TTTGTCATGGAGGAGTCAGTTGG - Intronic
1063805812 10:9638916-9638938 TTTGAGAGGTGGGAGTCATAGGG - Intergenic
1064425307 10:15224542-15224564 TGTGTGTTGTGGGAGGCACCTGG + Intronic
1065103131 10:22351539-22351561 ACAGTGAAGTGGGAGTCACTTGG + Intronic
1065805896 10:29393609-29393631 TTTGTGATGCAGGAGTTACCTGG - Intergenic
1068951295 10:62780331-62780353 TTTGGTATGTGGGAAACACTTGG - Intergenic
1072041319 10:91609428-91609450 TGTGTGATGTAGGAGTCAGGTGG - Intergenic
1072207310 10:93215667-93215689 TGTGTCATGTGGTAGTCACTGGG - Intergenic
1072278353 10:93844453-93844475 TTTCTGATGTTGGAGTCATAAGG - Intergenic
1072463911 10:95645808-95645830 TTCCTGCTGTGGGAGTCCCTGGG + Intronic
1073575281 10:104617949-104617971 ATGGTAATGTGGGAGTCACTAGG - Intergenic
1073717329 10:106122009-106122031 TCAGTGAGGTGGGAGACACTAGG - Intergenic
1075575532 10:123574518-123574540 TTTGTCATGAGTGAGTCACTAGG - Intergenic
1076016666 10:127033254-127033276 TTTGGGGTGTGGGAGTCAGCAGG - Intronic
1078741307 11:14068812-14068834 TTTGTGTTGTGAGAGTCATTCGG + Intronic
1079193874 11:18306763-18306785 TTTGTGGTGAGGAAGTGACTTGG - Intronic
1080401476 11:31940365-31940387 TATGTGCTCTGGGCGTCACTTGG + Intronic
1081407012 11:42709669-42709691 TTTGGGATGTGCTAGTCACAAGG - Intergenic
1081573068 11:44303437-44303459 TTGGTGAGGAGGGGGTCACTGGG - Intronic
1082635851 11:55592596-55592618 TATGTGTTGTGGGAGGGACTTGG - Intergenic
1083299866 11:61734693-61734715 TTGGTGACGTGGGGGTCACTAGG + Intronic
1083579483 11:63815659-63815681 TGTGTGATGAGGGACTGACTCGG - Intronic
1083714225 11:64566657-64566679 TGAGTGACGTGAGAGTCACTGGG - Intronic
1083923966 11:65794886-65794908 GTTTTGATTTGAGAGTCACTCGG + Intronic
1086333947 11:85781356-85781378 TGTGTGCTGTGGGAGGGACTTGG - Intronic
1087119846 11:94562023-94562045 TTTGGGATGTGGGAGGCAATTGG + Intronic
1087788448 11:102381917-102381939 TCTGTGATGTTGGCGTCACAGGG + Intergenic
1087920222 11:103858459-103858481 TTTGTGATTTGGGAGATTCTGGG - Intergenic
1089336408 11:117726821-117726843 ATTGTGATGTGGAGGTCTCTGGG + Intronic
1089396924 11:118142203-118142225 TGAGTGAGGTGGGAGCCACTGGG - Intronic
1089559590 11:119337127-119337149 TGTGTGATGTGGGAGTGACAGGG - Exonic
1091024208 11:132127484-132127506 TGTGTGATGTGGATGTCACAGGG - Intronic
1091107102 11:132933033-132933055 TTTATGATGGGCGAGTCAATGGG - Intronic
1094794343 12:33953237-33953259 TTTGTGTTGTGGGAGGGACCCGG - Intergenic
1096485005 12:51974132-51974154 TGTGTGATCTGGGACTCAGTTGG + Intronic
1096647218 12:53045448-53045470 TTAGAGCAGTGGGAGTCACTGGG - Intergenic
1096730292 12:53605692-53605714 ATTGTGATGTGTTAGTGACTGGG + Intronic
1096752101 12:53767015-53767037 TTTGTGGTGTGGAAGAGACTTGG + Intergenic
1097840701 12:64318767-64318789 GTTGTGATCTGGAAGTCCCTGGG + Exonic
1098690173 12:73477758-73477780 TTTGTGAAGTGGGAGGCAGAAGG + Intergenic
1103997858 12:124841754-124841776 CTTCTGATGTGGGAGTCAGGAGG - Intronic
1104949733 12:132433996-132434018 TTTCTGACTTGAGAGTCACTGGG + Intergenic
1105603157 13:21905183-21905205 TTTGGGATGTGGGAGGAAATGGG + Intergenic
1106391272 13:29337616-29337638 TTTGAGATGGGGGTCTCACTCGG + Intronic
1106937042 13:34734582-34734604 TTTGTTATTTGTGAGTCCCTTGG + Intergenic
1107130457 13:36888718-36888740 TTTGTGATGTGCATGACACTTGG + Intronic
1109100058 13:58172385-58172407 TTTGTGATTTGGTATTAACTTGG + Intergenic
1111495444 13:89042923-89042945 TTTGTGATGTGGGAGGAAACTGG + Intergenic
1112824836 13:103380450-103380472 TTTATGAGGTTGGAGTCAATTGG + Intergenic
1113975156 13:114222599-114222621 AGTGTGATGAGGGAGTCACAAGG + Intergenic
1115603805 14:34980750-34980772 TTTGTGATGTTAGAGTCAGTAGG - Intergenic
1116053273 14:39831483-39831505 TTTGGGATGTGGGAGGCAACTGG + Intergenic
1117891791 14:60430077-60430099 TTTGTGATGTGCAAGTCTATGGG - Intronic
1118673392 14:68155548-68155570 TTTGTTATTTGGGCTTCACTGGG + Intronic
1120612635 14:86661118-86661140 TTAGTGATGTGGAGGTCACTGGG + Intergenic
1120920938 14:89755038-89755060 TATGTGTTGTGGGAGGGACTTGG - Intergenic
1121613642 14:95298240-95298262 TTTGTGTTTTGTGATTCACTGGG - Intronic
1122714124 14:103683554-103683576 GTTGGGATGTGGGAGCCCCTTGG + Intronic
1124202060 15:27687038-27687060 TTCGTGAGGTGGGCGTGACTTGG + Intergenic
1126705827 15:51403958-51403980 TTAGTGAAGTGGGGGTCACATGG + Intronic
1127062273 15:55199017-55199039 TATGTGTTGTGGGAGGGACTTGG - Intergenic
1127841409 15:62835375-62835397 TTTCATATGTGGGAGCCACTAGG - Intronic
1128405073 15:67328872-67328894 TTTGAGTTGTGGTAGTGACTGGG + Intronic
1129164924 15:73771496-73771518 TTTGTGATGGGGCAGACACTGGG - Intergenic
1131018453 15:89077154-89077176 TTTGTGAGGTGGTAGAGACTGGG - Intergenic
1132329679 15:101003698-101003720 TATGTGTTGTGGGAGGCACCTGG - Intronic
1132336350 15:101050839-101050861 ATGGTGATTTGGGAGGCACTTGG + Intronic
1133625770 16:7569210-7569232 CTTGTGTTGTGGAAGTTACTAGG - Intronic
1133721576 16:8499237-8499259 TTTGGGATGTTGGAGTAACCTGG - Intergenic
1135221670 16:20620155-20620177 TTTGCAATGCGGGAGTCACTAGG - Intronic
1135591177 16:23706153-23706175 TGGGTGTTGAGGGAGTCACTTGG + Intronic
1138655639 16:58489673-58489695 TGTGTGCTGTGTGAGGCACTGGG - Intronic
1138910493 16:61391772-61391794 TTTCTGATGAGGAAATCACTAGG - Intergenic
1141293106 16:82738923-82738945 TCTGTGATGTGTGAGGCACAGGG - Intronic
1141299475 16:82800405-82800427 TTTATGATTTGGGTATCACTAGG - Intronic
1141872525 16:86797736-86797758 TGTCTGAAGTGGGACTCACTAGG + Intergenic
1146709866 17:35031706-35031728 ATCATGATGTGGGAGTAACTGGG + Intronic
1146947943 17:36886475-36886497 TATGTGATGTGGGGGGCACATGG + Intergenic
1149309558 17:55380883-55380905 CTTGACATGTAGGAGTCACTTGG - Intergenic
1149334915 17:55625796-55625818 TTTTGGATGTGTAAGTCACTAGG + Intergenic
1152052009 17:77986881-77986903 TTTGGTATGTGGTAGACACTAGG - Intergenic
1152137203 17:78511598-78511620 TTTGGGAAGTGGGTGGCACTAGG - Intronic
1153906038 18:9662176-9662198 TTTTTGAGGTGGAAATCACTGGG - Intergenic
1154404373 18:14075171-14075193 TATGTGTTGTGGGAGGAACTTGG - Intronic
1155501044 18:26487204-26487226 TTTATGATGTCAGAGTGACTAGG + Intronic
1157087017 18:44591263-44591285 TTTTTGTTCTGGGAGCCACTGGG - Intergenic
1157315009 18:46579684-46579706 TTGGTGATGTGGGGGACACGGGG - Intronic
1157431911 18:47635199-47635221 TTTGTGATGTGCCAGGCACTGGG + Intergenic
1163423979 19:17230823-17230845 TTTGAAATGTGGGCTTCACTGGG - Intergenic
1164466035 19:28488443-28488465 TTTTTGATGTGGTTTTCACTGGG + Intergenic
1167231224 19:48284940-48284962 TTTGAGATGAGGGTGTCACTAGG - Intronic
926958097 2:18323907-18323929 TTTGAGATGTTTGGGTCACTTGG - Intronic
927405426 2:22761098-22761120 TTTGTGATTTGGGAGGCACAGGG - Intergenic
927795210 2:26042048-26042070 TTAGTGATGTGGGAATTACATGG + Intronic
928424006 2:31163158-31163180 ATTCTGCTGTGGGAGTGACTGGG + Intergenic
928855797 2:35801207-35801229 TATGTGATGTGGAGTTCACTAGG + Intergenic
929699063 2:44146315-44146337 TTTGTTATCTTGGAGTAACTGGG - Intergenic
932758696 2:74425902-74425924 TGGTTGATGTGGGAGTCACAAGG + Exonic
933902648 2:86861044-86861066 TTTATGATGTTGCACTCACTGGG + Intronic
935251049 2:101261200-101261222 TTAGTGATGAGGCAGCCACTGGG - Intronic
935777900 2:106488224-106488246 TTTATGATGTGGCACTCACTGGG - Intergenic
935975817 2:108577475-108577497 TTAGTGATATGGTAGTCATTGGG + Intronic
936674613 2:114700545-114700567 TTTGTGATGTGGATGTAAATTGG - Intronic
937440480 2:121911139-121911161 TTTGTGTTGTCAGAGTCACAAGG + Intergenic
939404286 2:141736038-141736060 TTTGTGATGCTGGAGACACTGGG + Intronic
943266090 2:185734858-185734880 TTTCTGATGGATGAGTCACTGGG + Intergenic
944475105 2:200095560-200095582 CATGTGTTGTGGGAGGCACTCGG + Intergenic
944686753 2:202124367-202124389 TTTGTGATCTGCTAGTCACCTGG - Intronic
945911796 2:215658326-215658348 TTCTTTATATGGGAGTCACTTGG + Intergenic
947156787 2:227170591-227170613 TATGTGTTGTGGGAGGGACTCGG - Intronic
948329102 2:237151074-237151096 GTTGTAATGCAGGAGTCACTGGG - Intergenic
1169616956 20:7458731-7458753 TTTCAGATGTGGGAATCATTTGG + Intergenic
1170644065 20:18180845-18180867 TTTGTGTTGTGGGAGGGACCTGG - Intronic
1172277553 20:33688039-33688061 TTGGTGAGGTGGCAGTCACCTGG - Intergenic
1174658881 20:52193399-52193421 TTTGTGAAGTGCCAGGCACTGGG + Intronic
1175601954 20:60281471-60281493 TTTGTGATGTGAGAGCCAGATGG - Intergenic
1178865447 21:36323112-36323134 TTTGTCATTTGGAAGTCAGTTGG + Intronic
1179915987 21:44478664-44478686 CCTGTGCTGTGGGTGTCACTGGG - Intergenic
1180854904 22:19039516-19039538 TTTGTCATCAGGGAGGCACTGGG + Intronic
1182259349 22:29062022-29062044 TTTGTGATGTGGGTGTGGGTGGG + Intergenic
1182932051 22:34183767-34183789 TGTGTGAAGTGGGAGTCAAATGG + Intergenic
1184534570 22:45077759-45077781 CTGGTGATGTGGGAGCCCCTGGG - Intergenic
1184991961 22:48176520-48176542 TATGTGCTGTGGGAGGCACCTGG + Intergenic
950702992 3:14762901-14762923 TCTGAGTTGTGGGGGTCACTTGG - Intronic
951580395 3:24157150-24157172 TGTGTGAAGTGGGAGCCCCTGGG - Intronic
952392151 3:32889931-32889953 TTTGTGATCTGAGAGTGAGTTGG + Intronic
955747436 3:62154237-62154259 TTTGTGATCTGGAAGGGACTTGG - Intronic
956369515 3:68543172-68543194 TTAGTGATTTTGGAGTCCCTAGG + Intronic
959757867 3:109920776-109920798 TAGGTGATGTGTGAGGCACTGGG + Intergenic
960742773 3:120853180-120853202 TGTGTGATATGGGAGGCATTTGG + Intergenic
961673680 3:128551983-128552005 TTTGTGATGTGGAAGGCAAATGG + Intergenic
962716309 3:138128961-138128983 TTTGGGATGTAGAAGTCACTGGG + Intronic
963368318 3:144366818-144366840 TATGTGTTGTGGGAGGGACTTGG - Intergenic
966305415 3:178528115-178528137 TTTATGAACTGGGAGTCATTGGG - Intronic
966737093 3:183195719-183195741 TTTATGCTGTGGGAGGCAGTGGG - Intronic
969961340 4:10947646-10947668 TATGTGTTGTGGGAGGCACCTGG - Intergenic
970564886 4:17322180-17322202 TTTGTGATGTGCCAGACACTGGG + Intergenic
972757803 4:42067732-42067754 ATTGTGATGTGGGAGGAAGTTGG - Intronic
973129541 4:46633624-46633646 TTTTTGATGTGGGTGTTAGTGGG + Intergenic
977156527 4:93580816-93580838 TTTGTGGTATGGGGGTTACTGGG - Intronic
980990980 4:139738106-139738128 TTTGTTATGTGCCAGTCACTGGG - Intronic
981177068 4:141693992-141694014 CTGGTGATGTGGGAGACAGTGGG + Intronic
981770772 4:148304865-148304887 TTTGTGAGGTGGGAGCCTGTTGG + Intronic
984705968 4:182847444-182847466 TTGGTGGTGTTGGAGACACTTGG + Intergenic
988083669 5:26445227-26445249 TTTGAGATGTTTGGGTCACTGGG - Intergenic
988946661 5:36209823-36209845 TGTGTAATATGTGAGTCACTAGG - Intronic
992302754 5:75400967-75400989 TGTGTGATGTAAGTGTCACTTGG + Intronic
992804073 5:80319846-80319868 GTTTTGATGCAGGAGTCACTGGG + Intronic
994786234 5:104167983-104168005 TTTTTAATGTAGGAGTCAGTAGG - Intergenic
995036031 5:107535282-107535304 TTTGTTAGGTGGGGGTCATTAGG - Intronic
995907406 5:117142284-117142306 TTAGTGATTTGGAGGTCACTGGG - Intergenic
997460749 5:134050758-134050780 TTGGAGATGAGGGTGTCACTGGG + Intergenic
999915113 5:156250036-156250058 TGTGTGATGTGGCTGTCTCTGGG + Intronic
1001771749 5:174302152-174302174 TTTGTAAAGTGGGAGTCAGCAGG - Intergenic
1002812142 6:640759-640781 TCTGAGATGAGGGAGTCAGTGGG - Intronic
1004049668 6:12063907-12063929 TTTTAAATATGGGAGTCACTTGG - Intronic
1004584933 6:16990046-16990068 TATGTGTTGTGGGAGTCACCCGG + Intergenic
1004828929 6:19456063-19456085 TATGTGATGTGGGATGCCCTTGG - Intergenic
1005914722 6:30342263-30342285 GTTGGGATGTGGGAATGACTGGG + Exonic
1006675103 6:35756981-35757003 TTTAAGAAGTGGGGGTCACTGGG - Intergenic
1007242867 6:40439522-40439544 TTTCTGATTTGGGAGTTGCTGGG + Intronic
1008477889 6:51952218-51952240 TTTTTAATGTGGGGGACACTTGG - Intronic
1011376143 6:86689142-86689164 TTTCTGTTATGGGAATCACTGGG - Intergenic
1012629969 6:101453651-101453673 TTTGTGATTTTTCAGTCACTAGG + Intronic
1013219943 6:108069441-108069463 TTTGTGAAGTGCTAGTCATTTGG - Intronic
1016002149 6:139052729-139052751 TTTGTTATATGGTAGTCAGTTGG + Intergenic
1016870511 6:148811616-148811638 GTTCTCATTTGGGAGTCACTTGG + Intronic
1017221814 6:151974275-151974297 TTTGTTATGTGTCAGGCACTTGG + Intronic
1019102530 6:169642704-169642726 GGTGTGAGGCGGGAGTCACTGGG + Intronic
1019792643 7:3026947-3026969 TTCTTGATCTGGGTGTCACTGGG + Intronic
1023110598 7:36807078-36807100 TGTGGGGTGTGGGAGTCAGTTGG - Intergenic
1023639923 7:42247247-42247269 TTTGAGATATGGGAGTCTTTAGG - Intergenic
1023723930 7:43122768-43122790 TTTGTGATTTAGTAGTCCCTTGG - Intronic
1027307482 7:76915429-76915451 TTTGTCATATGTCAGTCACTGGG - Intergenic
1029505489 7:100961271-100961293 AGTCTGATGTGGGTGTCACTGGG + Intronic
1030673101 7:112358648-112358670 TCTGCCATGTGTGAGTCACTGGG + Intergenic
1032995188 7:137437675-137437697 TTTGTCCTTTGGGAGTGACTTGG - Intronic
1034720159 7:153284985-153285007 TTGGTCATATGGGACTCACTTGG + Intergenic
1034948415 7:155279668-155279690 TTTGGGATGTGGGAGGAACCCGG - Intergenic
1035130015 7:156642765-156642787 TTTGGGATGTGGGAGGAACCCGG + Intronic
1035953927 8:4054735-4054757 TTTGTGATGTGTCATTCTCTGGG + Intronic
1036722571 8:11190433-11190455 TGTGTAATGTGGAAGTCACGGGG + Intronic
1036767450 8:11557783-11557805 TTTGTAAAGTGGAAGGCACTCGG + Intronic
1039022290 8:33221186-33221208 TTTGTGTTGTGGAATTCTCTGGG - Intergenic
1039210609 8:35208905-35208927 GTAGTGATGTGGGAGTGACTGGG - Intergenic
1039378871 8:37066324-37066346 ATTTTGATGTCGGAGTCGCTCGG + Intergenic
1040698051 8:50026520-50026542 TTTGTGATGTGGTAGTCTTAGGG - Intronic
1042143231 8:65700644-65700666 TTAGTGATTTGGGAGTCCCAAGG - Intronic
1042675935 8:71321938-71321960 TTTGTGATGTGGTTGTTAATCGG - Intronic
1042782373 8:72506123-72506145 TTTGGGATGTGGGAGGAAATGGG - Intergenic
1043006941 8:74831560-74831582 TGTGTGCTGAGGGAGTCAGTGGG + Intronic
1043915971 8:85922354-85922376 TTGGTGATGTGAGAGTCACAGGG - Intergenic
1044260278 8:90111586-90111608 TTTGCGATGTGGAAGTCAAAAGG - Intergenic
1046034606 8:108825502-108825524 TTGGTGATGAGGTAGCCACTTGG + Intergenic
1046508896 8:115173114-115173136 TCTGTGAGGTGGGAGCCAGTTGG + Intergenic
1047724482 8:127672045-127672067 TGAGTGAGGTGGGAGCCACTGGG - Intergenic
1052990628 9:34517559-34517581 TTTCTGATGTGGGAGACCCAGGG + Intronic
1053111596 9:35465248-35465270 TTTGTGATGAGGGTTTCTCTGGG - Intergenic
1055229526 9:74044939-74044961 TTTGGGATGTGGGAGGAAATTGG - Intergenic
1055756938 9:79568310-79568332 GTTTTCATGTGGGAGGCACTTGG - Intergenic
1056811532 9:89768843-89768865 CATGTGTTGTGGGAGTGACTGGG + Intergenic
1056932182 9:90888353-90888375 TCTGTGATGTTGGAGTCAGTTGG - Intronic
1057957165 9:99419756-99419778 TTAGTGATGTTGGTGACACTAGG - Intergenic
1058247954 9:102654251-102654273 TTTGGGATGTGGGAGGAAATGGG + Intergenic
1059251230 9:112889741-112889763 TTTGTGCTGAGGGAGCCTCTCGG - Exonic
1060624301 9:125096348-125096370 TTTGTGTTGTGGGAGGGACCCGG - Intronic
1062108569 9:134769279-134769301 TTTGTGATGTGGGAGTCACTGGG - Intronic
1186441603 X:9591727-9591749 TTTATCATGTGTGTGTCACTTGG - Intronic
1186671729 X:11773954-11773976 TTGGGCAGGTGGGAGTCACTGGG + Intronic
1188009277 X:25039963-25039985 TTTCTGATGGGGAAGTCCCTTGG + Intergenic
1190443147 X:50495753-50495775 TTAGGGATTTGGGAGTTACTGGG - Intergenic
1190677834 X:52797281-52797303 TTTTTGCTGTTGGAGTCACAGGG + Exonic
1192337457 X:70234277-70234299 TTTGTGATGTGGGGAGCACCTGG - Intergenic
1192435262 X:71139415-71139437 TCTGTGCTGGGGAAGTCACTGGG + Intronic
1197448798 X:126584990-126585012 TTTGTGGGGTGGGATTGACTAGG + Intergenic