ID: 1062108570

View in Genome Browser
Species Human (GRCh38)
Location 9:134769280-134769302
Sequence GTTTGTGATGTGGGAGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062108570_1062108576 8 Left 1062108570 9:134769280-134769302 CCAGTGACTCCCACATCACAAAC 0: 1
1: 0
2: 0
3: 25
4: 196
Right 1062108576 9:134769311-134769333 CTTGGTCAGAAGAAGCAGAGTGG No data
1062108570_1062108573 -10 Left 1062108570 9:134769280-134769302 CCAGTGACTCCCACATCACAAAC 0: 1
1: 0
2: 0
3: 25
4: 196
Right 1062108573 9:134769293-134769315 CATCACAAACTGCCCTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062108570 Original CRISPR GTTTGTGATGTGGGAGTCAC TGG (reversed) Intronic
901017741 1:6241681-6241703 GTTTGTGATGGAGGAGCCACGGG + Intergenic
902752272 1:18525249-18525271 GTATGAGATGTGGGAGGCAGTGG - Intergenic
904163689 1:28539211-28539233 ATTTCTGTTTTGGGAGTCACTGG + Intronic
905058940 1:35122655-35122677 TTTTGTGATGTGGGAGTACCTGG + Intergenic
906290976 1:44619009-44619031 GTTGGTGATGGGGGAGGGACTGG + Intronic
906555197 1:46705519-46705541 TTTTGTGATGTGGGAGTACCTGG - Intronic
906665258 1:47616975-47616997 GATTGTGATATGGGGGTAACAGG - Intergenic
906740494 1:48178353-48178375 GTTTGTCAGGTGGGTGTTACAGG - Intergenic
909124867 1:71654929-71654951 TTTTGTATTGTGAGAGTCACTGG + Intronic
916585245 1:166144334-166144356 GATCTTGATGTGGGTGTCACAGG + Intronic
916996523 1:170307513-170307535 GTTTGTGTTGGGGGAGTCCCAGG + Intergenic
920139040 1:203794346-203794368 GTTGGTGATGTGCGAGTCCCAGG - Intergenic
921526036 1:216219975-216219997 ATTTGTGATGTAGGAGACAGAGG - Intronic
922649323 1:227323449-227323471 TTTGGTAATGTGGAAGTCACTGG - Intergenic
922712829 1:227845911-227845933 TTTTGTGAACTGGGAGTCCCAGG - Intronic
922712979 1:227846762-227846784 GTGTGTGTTGTGGGGGTAACCGG + Intergenic
923831855 1:237566860-237566882 GTTTGTGCTGTGGGAAACACTGG - Intronic
924350250 1:243107728-243107750 GTCTCTGATTTTGGAGTCACGGG + Intergenic
924909186 1:248490681-248490703 GTGTGTGATGTTGGAGCCAGGGG + Intergenic
924914919 1:248557377-248557399 GTGTGTGATGTTGGAGCCAGGGG - Intergenic
1063193921 10:3722382-3722404 TTTGGTGCTGTGGGATTCACTGG + Intergenic
1063393145 10:5663382-5663404 GTGAGTGATGAGGGAGTCAGGGG - Intronic
1063551940 10:7041874-7041896 CATTGTGAGGTGGGAGGCACGGG + Intergenic
1063805813 10:9638917-9638939 ATTTGAGAGGTGGGAGTCATAGG - Intergenic
1064648407 10:17483579-17483601 GTTAGTGATGAGGGACTCATAGG + Intergenic
1067377604 10:45742115-45742137 GTGTGTGGTGTGGGACTGACAGG + Intronic
1067885306 10:50082799-50082821 GTGTGTGGTGTGGGACTGACAGG + Intronic
1072207311 10:93215668-93215690 GTGTGTCATGTGGTAGTCACTGG - Intergenic
1073124040 10:101139081-101139103 GTTCGTGGTGTGGGGGTCACTGG + Intergenic
1073654901 10:105403448-105403470 GTTTGTGACCTGGGAGTAACAGG - Intergenic
1078460822 11:11514131-11514153 TTCTGTGATGTGGGAATCATTGG - Intronic
1079028663 11:16968710-16968732 GTTGGTGGTGGGGGAGTCATGGG - Intronic
1079116297 11:17642524-17642546 GTGTGTGGTGTGTGAGTGACTGG - Intronic
1079530704 11:21448732-21448754 GTTTGTCATTTGGAAGTGACAGG - Intronic
1080409018 11:32005966-32005988 GTTGGTTATGGGTGAGTCACAGG + Intronic
1081716807 11:45256272-45256294 TTTTGTGTGGTGGGAGCCACTGG - Intronic
1081979018 11:47254636-47254658 GTCTGAGATGGGGGTGTCACAGG + Intronic
1082126053 11:48432415-48432437 AACTGTGATGTGGGAGACACAGG + Intergenic
1082128960 11:48464248-48464270 AACTGTGATGTGGGAGACACAGG + Intergenic
1082248440 11:49953132-49953154 AACTGTGATGTGGGAGACACAGG - Exonic
1082653833 11:55827937-55827959 GGCTGTGAGGTGGGAGGCACAGG - Exonic
1082868003 11:57917494-57917516 GATGGTGAGGTGGGAGGCACAGG + Intergenic
1083714226 11:64566658-64566680 GTGAGTGACGTGAGAGTCACTGG - Intronic
1087788447 11:102381916-102381938 TTCTGTGATGTTGGCGTCACAGG + Intergenic
1088937360 11:114416752-114416774 GCTTGAGATTTGGAAGTCACAGG - Intronic
1089336407 11:117726820-117726842 GATTGTGATGTGGAGGTCTCTGG + Intronic
1089396925 11:118142204-118142226 GTGAGTGAGGTGGGAGCCACTGG - Intronic
1089559591 11:119337128-119337150 CTGTGTGATGTGGGAGTGACAGG - Exonic
1091024209 11:132127485-132127507 TTGTGTGATGTGGATGTCACAGG - Intronic
1091639245 12:2222296-2222318 GTTTGTGTTGAGTAAGTCACTGG + Intronic
1092110349 12:5957146-5957168 GTTTGTCACCTGGGAGTAACAGG + Intronic
1094057583 12:26282667-26282689 TCATGTGATGTGAGAGTCACTGG + Intronic
1095205671 12:39437320-39437342 GTTTGTTATTTGGGACTCAATGG - Intronic
1096113821 12:49043612-49043634 GTTAGTTATGTGGGAGTGAGTGG - Intronic
1096342576 12:50814363-50814385 GTCTGAGAGGTGAGAGTCACAGG - Exonic
1096647219 12:53045449-53045471 GTTAGAGCAGTGGGAGTCACTGG - Intergenic
1097902664 12:64888902-64888924 GATTGTGATCTGGGAGGCAACGG + Intergenic
1099257232 12:80329056-80329078 GTTGGTTCTGTGGGAATCACAGG - Exonic
1100359897 12:93867090-93867112 GTTTATGATTTGGGAGTAAAGGG - Intronic
1101554433 12:105795043-105795065 GATTGTGATGAGTGGGTCACCGG - Intergenic
1101900008 12:108784900-108784922 GTCTGTGCTGTGCAAGTCACTGG - Exonic
1104155450 12:126126732-126126754 GATTGTGAGATGGGACTCACAGG - Intergenic
1104949732 12:132433995-132434017 GTTTCTGACTTGAGAGTCACTGG + Intergenic
1104991505 12:132626288-132626310 GTTTGTGATGTTGGTGTCCAGGG + Exonic
1106099558 13:26682671-26682693 GTTTGTGCTGAGGGAATCACAGG - Exonic
1108263360 13:48679882-48679904 GTTTCCAATGTGGGAGTTACAGG + Intronic
1109967543 13:69720962-69720984 TTTAGTGATTTGGGAGTCCCAGG - Intronic
1113123883 13:106954990-106955012 GTTTGAGATGAGGGAGTCGGAGG + Intergenic
1113555829 13:111233210-111233232 GTTCCTGATTTGGGAGACACAGG - Exonic
1113738318 13:112693510-112693532 GTATGTGCTGTGGGAGCCATGGG + Intronic
1113824209 13:113238002-113238024 GCTTGTGAGCTGAGAGTCACGGG + Intronic
1120612634 14:86661117-86661139 CTTAGTGATGTGGAGGTCACTGG + Intergenic
1120707519 14:87760179-87760201 GTTTGAGATAATGGAGTCACAGG - Intergenic
1125245392 15:37630793-37630815 TTTTGTGGGGTGGGAGTCAGAGG - Intergenic
1128871555 15:71160900-71160922 ATTTTTGAGGTAGGAGTCACAGG + Intronic
1129164925 15:73771497-73771519 ATTTGTGATGGGGCAGACACTGG - Intergenic
1129606144 15:77025926-77025948 GTCTGAGTTGTGGGGGTCACTGG + Intronic
1129657229 15:77532268-77532290 GTTGGAGATGGGGGAGTCAGGGG + Intergenic
1131300663 15:91196946-91196968 GTTTGTGAAGTGTCTGTCACAGG - Intronic
1132054128 15:98636148-98636170 GATTCTGATGTGGGTGGCACAGG + Intergenic
1135397748 16:22144123-22144145 GTTTGAAATGTGGGATTCCCAGG - Intronic
1138746295 16:59366922-59366944 GTTTGGGCTGTGGGAGGCACTGG + Intergenic
1139210671 16:65073654-65073676 GTTTGGGATGAGTGAGTCACTGG - Intronic
1140339068 16:74139522-74139544 ATTTGGGCTTTGGGAGTCACAGG - Intergenic
1141293107 16:82738924-82738946 GTCTGTGATGTGTGAGGCACAGG - Intronic
1141834720 16:86531321-86531343 CTTTGTGCTGTGGGAGAGACCGG - Exonic
1142744039 17:1946262-1946284 GTTTTTGTTGAGGGAGGCACAGG - Intronic
1143290695 17:5825831-5825853 GTTTATGATGAGGGCTTCACTGG - Intronic
1143886789 17:10070987-10071009 GATGGGGATGTGGGAGTCCCTGG - Intronic
1149057682 17:52385186-52385208 GTTTTTGATTTGGGAATCAGAGG + Intergenic
1150201205 17:63359739-63359761 GATTGTGATGTGGGAGCCTAAGG + Intronic
1152695693 17:81793089-81793111 GTGTGTGATGTGGGTGTTTCTGG - Intergenic
1152737496 17:82004604-82004626 GTGTGTCATGTGGCAGCCACAGG + Intronic
1153221923 18:2869367-2869389 GATTGTGATGTTGGTTTCACGGG - Intronic
1153778534 18:8474977-8474999 GTGTGTGATGTGTGTGTCAATGG - Intergenic
1155455668 18:26009883-26009905 GTTTGGGATCTGGGAGACAAAGG - Intergenic
1155624603 18:27820013-27820035 GTTTCAGATGTGGGATTCAAAGG - Intergenic
1155823952 18:30415483-30415505 GTTTGTGTTGTAGGAGCCAGGGG + Intergenic
1157087018 18:44591264-44591286 GTTTTTGTTCTGGGAGCCACTGG - Intergenic
1157315010 18:46579685-46579707 TTTGGTGATGTGGGGGACACGGG - Intronic
1157431910 18:47635198-47635220 ATTTGTGATGTGCCAGGCACTGG + Intergenic
1160040947 18:75344988-75345010 GGTTGGGATGAGGGAGGCACAGG + Intergenic
1160318230 18:77867509-77867531 GTTTTGGATGTGGGCTTCACGGG + Intergenic
1160493314 18:79355657-79355679 GTTTGTGCCGTGGGAGTTCCAGG + Intronic
1168628200 19:57935321-57935343 GTTTGTGAGGTGAGAGGCGCTGG - Exonic
924965877 2:76114-76136 TTTTATGATGAGAGAGTCACTGG + Intergenic
925597292 2:5568400-5568422 CTTTCTGATGTGGGTGTTACTGG + Intergenic
927405427 2:22761099-22761121 TTTTGTGATTTGGGAGGCACAGG - Intergenic
930899821 2:56491236-56491258 GTTTAAGAAATGGGAGTCACTGG + Intergenic
931924213 2:67053752-67053774 GTTTCTGATGTAGCAGTCAATGG - Intergenic
935213987 2:100961705-100961727 GATTGTGAAGTGGGAGGCCCTGG - Intronic
935251050 2:101261201-101261223 GTTAGTGATGAGGCAGCCACTGG - Intronic
935777901 2:106488225-106488247 ATTTATGATGTGGCACTCACTGG - Intergenic
935975816 2:108577474-108577496 GTTAGTGATATGGTAGTCATTGG + Intronic
939404285 2:141736037-141736059 GTTTGTGATGCTGGAGACACTGG + Intronic
941580624 2:167292833-167292855 GTTTGGGATGGGGGAGGCGCGGG - Intergenic
943266089 2:185734857-185734879 GTTTCTGATGGATGAGTCACTGG + Intergenic
944531635 2:200673449-200673471 GTCTTTGATGTGGGATTGACAGG - Intronic
948256536 2:236572693-236572715 CTTTGTGACGTGGGAATCTCTGG + Intronic
1171042858 20:21781706-21781728 GGAAGTGATGTGGGAATCACAGG + Intergenic
1171895242 20:30752364-30752386 ACTTGGGCTGTGGGAGTCACAGG + Intergenic
1174130283 20:48339750-48339772 GTTTGTGATGAGGGAGTGGAGGG - Intergenic
1174658880 20:52193398-52193420 GTTTGTGAAGTGCCAGGCACTGG + Intronic
1175502650 20:59461289-59461311 GCTTGTGATGTGGGTGACTCGGG + Intergenic
1177046799 21:16181118-16181140 TTTTGTTATGTTGGTGTCACTGG + Intergenic
1177408933 21:20705211-20705233 GTTTGTGATGTGGATGGCAGAGG - Intergenic
1178759898 21:35392436-35392458 GTTTGTGGTGTGGCAGCCCCAGG + Intronic
1179912716 21:44458950-44458972 GTGTGTGCAGTGTGAGTCACGGG + Exonic
1180356679 22:11849000-11849022 ACTTGTGCTGTGGGAGTCGCAGG - Intergenic
1180381583 22:12143331-12143353 ACTTGTGCTGTGGGAGTCGCAGG + Intergenic
1182259348 22:29062021-29062043 GTTTGTGATGTGGGTGTGGGTGG + Intergenic
1183886960 22:40891918-40891940 GTTTCTGCTGTGGGAATCACTGG + Intronic
1184732138 22:46376876-46376898 GGTGGAGATGTGGGATTCACTGG - Intronic
1185366210 22:50438065-50438087 GTTCGGGATGTGGGAGCCCCGGG - Intronic
950745249 3:15082849-15082871 GTTTGTTGTGTTGGAGGCACAGG - Intronic
954066462 3:48110598-48110620 GTTTGTGGTGTAGGAGCAACAGG + Intergenic
959757866 3:109920775-109920797 GTAGGTGATGTGTGAGGCACTGG + Intergenic
960529442 3:118746538-118746560 GTTAGTGTTTTGGGAGTCAGTGG + Intergenic
962716308 3:138128960-138128982 CTTTGGGATGTAGAAGTCACTGG + Intronic
963867464 3:150378207-150378229 GTTTGTGTTGGGGGAGTGTCAGG - Intergenic
966647399 3:182261920-182261942 GTTTGAAGTATGGGAGTCACTGG - Intergenic
970074001 4:12196716-12196738 GTGGGTGATGTTTGAGTCACAGG - Intergenic
970564885 4:17322179-17322201 GTTTGTGATGTGCCAGACACTGG + Intergenic
973171662 4:47152663-47152685 GTTTGTGTTGTGGGTGTCAGTGG - Intronic
975395900 4:73872951-73872973 GTTTTTGGCGTGGTAGTCACAGG + Intergenic
975619710 4:76283996-76284018 GTTTGAGATGTTTGAGTCATGGG + Intronic
978400484 4:108325455-108325477 GTTTGTCATGAAGGATTCACAGG - Intergenic
979251686 4:118572824-118572846 GTCTCTGATTTTGGAGTCACGGG - Intergenic
980990981 4:139738107-139738129 GTTTGTTATGTGCCAGTCACTGG - Intronic
983643883 4:169970159-169970181 GTTGGTGAGTTGGGAGTCAAAGG - Intergenic
984078251 4:175210417-175210439 GTTTGATATGTGGTAGTCATTGG - Intergenic
984632366 4:182074382-182074404 CTTGGTGATGTGTGAGTCAAAGG - Intergenic
984979790 4:185269114-185269136 GTTTGTTATGTGAGGCTCACAGG + Intronic
985385704 4:189445739-189445761 GTTTTTAATGTAGGAGTCATTGG - Intergenic
988439694 5:31218837-31218859 GTTAGTGCTGTGGGAACCACGGG - Intronic
990375004 5:55161016-55161038 GTCTGTGAGTTGGCAGTCACTGG - Exonic
991058325 5:62343566-62343588 GTGTGAGATGGGGGAGTCATTGG + Intronic
992804072 5:80319845-80319867 GGTTTTGATGCAGGAGTCACTGG + Intronic
992890824 5:81202468-81202490 GTTTGTGATGTGTTAGCAACTGG + Intronic
994730266 5:103483267-103483289 GTTTGCCAGGTGGCAGTCACAGG - Intergenic
995401968 5:111752595-111752617 GTTTGTGAAGTGGCATTCATGGG - Intronic
996196007 5:120608005-120608027 AGTTGTGATGCTGGAGTCACAGG + Intronic
996851754 5:127960786-127960808 GTGTGTGTTGTGGGCATCACAGG - Intergenic
998055658 5:139074717-139074739 GTTTGTGAGGTGGGAGTGGAAGG + Intronic
999935743 5:156484062-156484084 GCTTGACATGTGGGATTCACTGG - Intronic
1001935055 5:175697710-175697732 GTATGTGATCTGGCAGGCACCGG - Intergenic
1002812143 6:640760-640782 GTCTGAGATGAGGGAGTCAGTGG - Intronic
1005259597 6:24043557-24043579 GTATGTGAGGTGGGAGTCTAAGG - Intergenic
1005914721 6:30342262-30342284 GGTTGGGATGTGGGAATGACTGG + Exonic
1006166272 6:32067660-32067682 GTGTCTGCTGTGGGCGTCACGGG - Intronic
1007924977 6:45643196-45643218 GTCTGTGATGTGGGAGGGAAAGG - Intronic
1008685811 6:53925215-53925237 GTTTGTCTTGTGGGAGTGACAGG + Intergenic
1011376144 6:86689143-86689165 GTTTCTGTTATGGGAATCACTGG - Intergenic
1011944817 6:92887849-92887871 GTTTGGTATGTAAGAGTCACAGG + Intergenic
1012170053 6:96005563-96005585 GTATGTGAATTGTGAGTCACAGG - Intergenic
1013411313 6:109886700-109886722 GTCTGTGTTGTGGGAATCAAAGG + Intergenic
1015006469 6:128287562-128287584 GTTTGTGATGTTGAATTTACAGG - Intronic
1015868548 6:137752478-137752500 GTTTGTCATGTGGAAGGCATGGG - Intergenic
1016012227 6:139149262-139149284 GTGTGAGATTTGGGAGACACAGG + Intronic
1016426304 6:143939344-143939366 GTATGTGTTGTGGAACTCACAGG + Intergenic
1018166599 6:161103697-161103719 GTTTGGGATGTGGGAGGCTGGGG + Intronic
1018303573 6:162429638-162429660 GTTTGTGTCGTGGGTGTGACAGG - Intronic
1019102529 6:169642703-169642725 GGGTGTGAGGCGGGAGTCACTGG + Intronic
1019362369 7:611473-611495 GTTTGTGATCTCTGAGCCACAGG - Intronic
1024188479 7:46980527-46980549 GTTTGTGAGGTAGGATTCTCAGG - Intergenic
1026279938 7:68913386-68913408 GTTTGTGATCTCTGAGTCATTGG - Intergenic
1027656366 7:80935528-80935550 GTTTCTGAAGTGTGAGGCACGGG + Intergenic
1027877397 7:83788063-83788085 GTTGGTGTTGCGGGATTCACAGG + Intergenic
1029039134 7:97554551-97554573 TTTTGTGGTGTGGGAGCCACGGG - Intergenic
1030520123 7:110588317-110588339 GTTTTTGAAGTGGGAGTCCTTGG - Intergenic
1031050246 7:116937671-116937693 GTTTGAGATGTGTGGGTCAATGG - Intergenic
1036722570 8:11190432-11190454 TTGTGTAATGTGGAAGTCACGGG + Intronic
1038004402 8:23417658-23417680 GTTGGTGAGGCGTGAGTCACAGG - Intronic
1038175486 8:25178456-25178478 ATTTGTGAGGTGGGAATGACCGG + Intergenic
1039210610 8:35208906-35208928 CGTAGTGATGTGGGAGTGACTGG - Intergenic
1039741871 8:40390211-40390233 GTTTGTGCAGTGGGAGCCTCTGG + Intergenic
1040698052 8:50026521-50026543 ATTTGTGATGTGGTAGTCTTAGG - Intronic
1041255330 8:55975383-55975405 GTCTGTGAGATGGGAGGCACAGG + Intronic
1043915972 8:85922355-85922377 TTTGGTGATGTGAGAGTCACAGG - Intergenic
1044603717 8:94031121-94031143 GTGTGTGATGCGGGGGTCAGGGG + Intergenic
1044725887 8:95193833-95193855 GGTTGTGATAAGAGAGTCACAGG + Intergenic
1047703598 8:127474454-127474476 GTGTGTGACTTGGGAGCCACAGG - Intergenic
1052990627 9:34517558-34517580 GTTTCTGATGTGGGAGACCCAGG + Intronic
1053422788 9:37990420-37990442 GGTTCTGCTGTGGGAATCACAGG - Intronic
1054353406 9:64040403-64040425 ACTTGGGCTGTGGGAGTCACAGG - Intergenic
1055869299 9:80855126-80855148 ACTTGGGCTGTGGGAGTCACAGG - Intergenic
1058093894 9:100837192-100837214 ACTTGTGCTTTGGGAGTCACAGG + Intergenic
1058811477 9:108643830-108643852 GTGTGTGGGGTGGGGGTCACTGG - Intergenic
1059396614 9:114038163-114038185 GGCTGTGCTGTGGGAGTCTCAGG - Intronic
1059536631 9:115086811-115086833 GTGTGTGATGAGGGTTTCACGGG - Exonic
1060194167 9:121612528-121612550 GTTTCTGCTGTGTAAGTCACCGG + Intronic
1060229083 9:121813864-121813886 GATTGTGATCTTGGACTCACAGG + Intergenic
1060874427 9:127070547-127070569 ATTTGTAATGTGGGAGAAACAGG - Intronic
1062108570 9:134769280-134769302 GTTTGTGATGTGGGAGTCACTGG - Intronic
1062130108 9:134887999-134888021 CGTTTTGATGAGGGAGTCACAGG - Intergenic
1185839323 X:3374000-3374022 GTTTGGGATGTGGGAGGCAGAGG + Intergenic
1186974593 X:14888119-14888141 GTTTTTGATGTGGTTTTCACTGG + Intronic
1187588128 X:20686410-20686432 GTTGGTGATGTTTGAGTCATGGG + Intergenic
1190677833 X:52797280-52797302 ATTTTTGCTGTTGGAGTCACAGG + Exonic
1193336065 X:80290903-80290925 GTTGGTGCTGTGGCAGTCAGAGG - Intergenic
1194838844 X:98714537-98714559 GTTTGTGGTGTGGCATTCCCAGG + Intergenic
1195449447 X:104994432-104994454 GATTGTGATGTGAGACACACAGG + Intronic