ID: 1062108571

View in Genome Browser
Species Human (GRCh38)
Location 9:134769289-134769311
Sequence GAAAGGGCAGTTTGTGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062108571_1062108578 30 Left 1062108571 9:134769289-134769311 CCCACATCACAAACTGCCCTTTC 0: 1
1: 0
2: 1
3: 27
4: 209
Right 1062108578 9:134769342-134769364 CATCCCCACGCGCGCAGCTGTGG No data
1062108571_1062108576 -1 Left 1062108571 9:134769289-134769311 CCCACATCACAAACTGCCCTTTC 0: 1
1: 0
2: 1
3: 27
4: 209
Right 1062108576 9:134769311-134769333 CTTGGTCAGAAGAAGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062108571 Original CRISPR GAAAGGGCAGTTTGTGATGT GGG (reversed) Intronic
900740425 1:4327670-4327692 GCAAGGGCAGTGGGTGATGGGGG - Intergenic
902169687 1:14599495-14599517 GAAAGGGCACTTTCTGATGCCGG - Intronic
902708285 1:18221481-18221503 GAAAGGGCGGGGAGTGATGTCGG + Intronic
906387549 1:45384232-45384254 GAAGGAGCAGTTAGTGAGGTAGG - Intronic
907607575 1:55833752-55833774 GAAACAGCAGTCTGAGATGTTGG - Intergenic
908089326 1:60669904-60669926 GAAAAGGCAATTTTTGAAGTGGG + Intergenic
909292492 1:73901611-73901633 GAAATGGCACTCTCTGATGTTGG - Intergenic
909879896 1:80861760-80861782 GAAATGGCATTTTGCCATGTCGG - Intergenic
910633749 1:89384250-89384272 GAGAGAGCAGATTATGATGTTGG + Exonic
910985709 1:93002774-93002796 GAAAGAGCACTTTGTAATATGGG - Intergenic
911157512 1:94651847-94651869 GAAAGGGGAGATTGGGAAGTTGG + Intergenic
912745515 1:112242561-112242583 GAAAGGCCGGTTTGGGAGGTGGG + Intergenic
913498837 1:119452213-119452235 GAAAGGACAGTGTGTGACCTTGG - Intergenic
915120793 1:153628627-153628649 GTGAGGGCAGTTTGGGATTTGGG + Intronic
915363000 1:155297040-155297062 GAAAGAGCAGCTAGTGAGGTAGG - Intronic
915874282 1:159595760-159595782 GAAAGGTCAGTGTAAGATGTGGG - Intergenic
917969877 1:180199692-180199714 GCAAGGACAGGTTGTGATGAGGG + Exonic
920044635 1:203125478-203125500 GAAGGGGAAGTTTGTGATGGAGG - Intronic
920193412 1:204210275-204210297 GAAAGGGCAGTTAGAGCAGTAGG - Intronic
920940275 1:210475513-210475535 GAAAGGGAAGTCTGTCATGTAGG - Intronic
921904513 1:220482516-220482538 GGATGGGCAGTTTGTTATATAGG - Intergenic
922177044 1:223204893-223204915 GAAAGGCCAGTTTTGGGTGTGGG + Intergenic
923480241 1:234376993-234377015 GCATGGTCAGTTTGTGATGAGGG + Intronic
923886126 1:238158511-238158533 GGAAGGGCAGTATGAGGTGTGGG - Intergenic
1064034494 10:11904166-11904188 GACAGGGGATTTTGTCATGTTGG + Intergenic
1065661218 10:28005824-28005846 TAAAGGTCAGTTTCTGCTGTTGG - Intergenic
1065761652 10:28988313-28988335 GAAATGGGATTTTGTTATGTTGG - Intergenic
1066654341 10:37684754-37684776 GCAAGGGCAGGTAGTGAAGTAGG - Intergenic
1068117455 10:52750667-52750689 GAGAGGGCAGTCTGTAAAGTGGG + Intergenic
1068333325 10:55600716-55600738 GTAAGGGCACTTTGTGAAGTGGG - Intronic
1068413083 10:56683232-56683254 GAAAAGTCAGTCTGTGGTGTGGG + Intergenic
1068711392 10:60139108-60139130 AAAAGGGAAGCTTTTGATGTGGG - Intronic
1069770162 10:70893534-70893556 GAAGGGGCTGTTTTTGCTGTGGG + Intergenic
1070020395 10:72579413-72579435 GAAAGGGTAAATTGTAATGTTGG - Intronic
1070437434 10:76406964-76406986 GAATGGGCAGATTCTGAAGTGGG - Intronic
1073567020 10:104543636-104543658 GAGAGGGCTGTATGGGATGTAGG + Intergenic
1077919916 11:6634082-6634104 CCAAGGGCAGGTTGGGATGTTGG - Intronic
1078550862 11:12279818-12279840 CAGAGGGAAGTATGTGATGTGGG - Intronic
1078663192 11:13303715-13303737 GAGAGGGTAGTTTGTGAGGAAGG + Intronic
1081724120 11:45314998-45315020 TAAAAGGGAGTTTGTGATCTAGG - Intergenic
1082582433 11:54889023-54889045 GAGAAGCCACTTTGTGATGTGGG + Intergenic
1083592992 11:63906174-63906196 AAAAGGGGAGTTAGTGATGGAGG - Intronic
1083788900 11:64971519-64971541 GAAAGGGCAGTCTCTGGAGTCGG + Intronic
1083866166 11:65454629-65454651 GAAAGGGCAAATTCTGATTTGGG + Intergenic
1085879006 11:80443435-80443457 GAAAAGGCGGTTGGAGATGTAGG + Intergenic
1085880859 11:80464522-80464544 GGATGGGCAGTCTGTGCTGTGGG - Intergenic
1087325089 11:96711773-96711795 GAAAAGGCTATTTGTCATGTAGG + Intergenic
1088390116 11:109305111-109305133 GAGACGGCAGTTTGCCATGTTGG + Intergenic
1088845848 11:113666193-113666215 GAAAGTGTAGTCTGTGTTGTTGG + Intergenic
1089827694 11:121293252-121293274 GAAAATGCAGTGTTTGATGTTGG + Intronic
1089979229 11:122758499-122758521 GAAAGGGCAGTCAGTGGTGGGGG + Intronic
1089981593 11:122777182-122777204 GAACTGGCAGAGTGTGATGTGGG - Exonic
1090665568 11:128912946-128912968 GAAGGGGCAGTTTGTCCTGTTGG - Intronic
1095493114 12:42757036-42757058 GAAAGAGCACTTTGTGATTTTGG - Intergenic
1096418167 12:51431792-51431814 TAAAGGGCAGTTTGGGGTGCAGG + Intronic
1097819485 12:64113857-64113879 CACAGGGCAGTTTCTGAGGTGGG - Intronic
1102572358 12:113834700-113834722 GAGAGGGCAATTTGGGATTTAGG + Intronic
1102992990 12:117328006-117328028 CAAAGGGCAGTTTGGGAGGAAGG + Intronic
1104102606 12:125627805-125627827 GGAAGGGCAGTGGGTGCTGTGGG - Intronic
1105479078 13:20756858-20756880 GAATGGGGAGTGTGTGCTGTTGG - Intronic
1106331859 13:28746668-28746690 GAAAGGTCATTTTGTGCTGGTGG + Intergenic
1106596324 13:31142629-31142651 GAAATGCCATTTTGTGATGCTGG - Intronic
1107417213 13:40211792-40211814 GAAGAGGCAGTCTGTGAGGTAGG - Intergenic
1117550950 14:56835411-56835433 GAAGAGGGAGTTTGTGATGGAGG + Intergenic
1118589024 14:67387066-67387088 GAAATGGCTGTTTGTGATGCTGG + Exonic
1119081386 14:71697527-71697549 GGAAGGGCAGTTTGCGTTATTGG + Intronic
1119174206 14:72557294-72557316 GAGAGTGCAGTCTGAGATGTCGG - Intronic
1124068207 15:26365839-26365861 GAAACAGCATTTTGTCATGTTGG + Intergenic
1124468033 15:29957382-29957404 AAAAGGGGAGTTTGGGATGAGGG - Intronic
1127736882 15:61849412-61849434 GAGAGGGATGTTGGTGATGTTGG + Intergenic
1128622050 15:69159479-69159501 GAAAGGGCACTTCTTGCTGTGGG + Intergenic
1130034746 15:80348183-80348205 GAAAGGGCTATTGGGGATGTAGG - Intronic
1130072111 15:80656428-80656450 GTAAGGACACTTTGTGAGGTAGG - Intergenic
1130178939 15:81606016-81606038 GCCAGGGCAGTGTGCGATGTTGG + Intergenic
1133084484 16:3351149-3351171 GATAGGGCATTTTGAGGTGTTGG - Intergenic
1134146399 16:11767057-11767079 GAAATGTCAGTATGTGGTGTAGG - Intronic
1134754971 16:16658964-16658986 GAAATGGCTGTTTGTGGTCTGGG - Intergenic
1134991092 16:18700185-18700207 GAAATGGCTGTTTGTGGTCTGGG + Intergenic
1135035259 16:19071838-19071860 GAAAGGGCACTTTGGGATGGAGG - Intronic
1135204105 16:20467893-20467915 GAAAGGGCAGTTTGTGAAGGAGG - Intronic
1135214894 16:20557066-20557088 GAAACGGCAGTTTGTGAAAGAGG + Intronic
1135684317 16:24486048-24486070 GAAAGGGCAGGTAGAGATGTGGG + Intergenic
1138951839 16:61921468-61921490 GAAAGCTCAGATTTTGATGTGGG - Intronic
1139665747 16:68454204-68454226 GAAAGGCCAGTTTGTTATATGGG + Intergenic
1141534582 16:84670257-84670279 GGAAGTGCAGTGTGTGATGGAGG + Intergenic
1141718066 16:85738515-85738537 GAAATGGGATTTTGTCATGTTGG + Intronic
1142326780 16:89421046-89421068 GAAGGGTCAGTGTGTGATGACGG + Intronic
1142326800 16:89421129-89421151 GAAGGGTCAGTGTGTGATGACGG + Intronic
1142549660 17:731040-731062 AACACGGCAGTTAGTGATGTAGG - Intergenic
1143032587 17:3976260-3976282 GAAAAGGCATTTTGAGATCTGGG + Intergenic
1144389765 17:14783090-14783112 GAAAGGGGAGATGGGGATGTAGG + Intergenic
1145239092 17:21229178-21229200 GACAGGGTAGTGTGTGTTGTAGG + Intergenic
1148440717 17:47710424-47710446 GACAGGGCAGGCTGGGATGTGGG + Intronic
1149153565 17:53598718-53598740 GAGGCTGCAGTTTGTGATGTAGG - Intergenic
1154191742 18:12236103-12236125 GAAGGAGCAGTGCGTGATGTTGG + Intergenic
1155225139 18:23722966-23722988 GAAAGGGCAGTCTGTGGGCTGGG + Intronic
1158047145 18:53169941-53169963 GGAAGGGCAGTTTATTATGTGGG - Intronic
1158901592 18:61966932-61966954 GAGAGGGGATTTTGTCATGTTGG + Intergenic
1160490835 18:79335689-79335711 GTAAGCGCAGTTAGTGATGGAGG - Intronic
1162684334 19:12369246-12369268 GAAGGGGAAGTTTGTAATATGGG + Intergenic
1165046301 19:33107727-33107749 GGAAGCGCAGTGTGTGATGGGGG - Intronic
1165258105 19:34592181-34592203 GAAAGGGCATTTTGGGCAGTGGG + Intergenic
925709639 2:6726468-6726490 GAAATGAAAGTTTGTGATTTGGG + Intergenic
926001371 2:9335726-9335748 GCAGGGACAGTTTGTGTTGTGGG + Intronic
927043823 2:19256770-19256792 GAAAGGGAAATTTGGGATGGAGG - Intergenic
927990613 2:27444320-27444342 GAAAAGGCACTGTGTGGTGTTGG + Intronic
928961929 2:36935196-36935218 GAAAGGGCATTTGGAGAGGTAGG - Intronic
929581512 2:43084358-43084380 GAAAGGGGAGTGTGAGATGCAGG + Intergenic
932011851 2:67986130-67986152 GAAAGGGCATGGGGTGATGTTGG + Intergenic
932287142 2:70544870-70544892 GAAAGGGTAGTGGGTGGTGTGGG + Intronic
935943644 2:108267555-108267577 GGAAGGGCAGTTTCTGCTGTGGG - Intergenic
936624400 2:114132937-114132959 GAGAGCGCATTTTGTGATTTTGG + Intergenic
937391234 2:121488440-121488462 GCATGGGCAGTTTGTGACCTGGG - Intronic
937864710 2:126740608-126740630 GAAAGAGTGGTTTATGATGTTGG + Intergenic
939934409 2:148273171-148273193 GCAAAGGCATTTTGTGAGGTTGG - Intronic
946301634 2:218827789-218827811 GAAAGGGCTGTTGGTGATGGTGG - Intronic
946492987 2:220167997-220168019 GGAAGTGCACTTTGGGATGTGGG + Intergenic
948698448 2:239745984-239746006 GAAAGGGAAGTTTGTTTTGGTGG + Intergenic
948915385 2:241032161-241032183 GAGAGGGGAGTTCGTCATGTTGG - Intronic
948960486 2:241331575-241331597 GAAATGGCATTTTGTCATATTGG + Intronic
1169149888 20:3281213-3281235 GAAATGGGATTTTGTCATGTTGG + Intronic
1169226840 20:3862181-3862203 CAAAGGGCAGCTTGTGCTCTTGG - Intronic
1171230739 20:23482154-23482176 AGAAGGGCAGTTGGTGATATGGG - Intergenic
1172827977 20:37806480-37806502 GAAAGGGCAGGTTGGGTTTTAGG + Intronic
1176037262 20:63045675-63045697 GAAGGGGCAGGTTTTGGTGTTGG + Intergenic
1176665541 21:9683659-9683681 GAAAGGGCAGTGTTTTATATGGG - Intergenic
1178978922 21:37244700-37244722 GAAAATGCAGTTTGTGGTTTTGG - Intronic
1179790680 21:43754323-43754345 GACATGGCAGGTTGGGATGTGGG + Intronic
1180248052 21:46561669-46561691 GAAAGGGCAGATCATGACGTTGG - Intronic
1182223073 22:28773610-28773632 GAAAGGGACGTTTGGTATGTGGG + Intronic
1182663548 22:31942099-31942121 GATAGGGCAGTGTGTGAAGAGGG + Intronic
951694600 3:25433077-25433099 GAAATGGGAGTTTTTGATGAAGG + Intronic
952152468 3:30607269-30607291 GAAAGGGAAGTTTGAGAAGTTGG + Intronic
952172721 3:30826631-30826653 GAAATGGCTGTTTATAATGTTGG - Intronic
954128409 3:48546604-48546626 GAAAGGCCTGCTTGTGAGGTTGG + Intronic
955583388 3:60449519-60449541 GTAAGTACAGTTTGTGATGTTGG - Intronic
955603680 3:60675577-60675599 GGAAGGGCTGGTTGTGATGACGG - Intronic
956380432 3:68659176-68659198 GGAGGGGCACTTTGTGAAGTGGG + Intergenic
957977968 3:87471896-87471918 AAAAGGGCACTTTGTGGTGTGGG + Intergenic
960356561 3:116660993-116661015 GAAAGGGGGGTATGTTATGTAGG - Intronic
964311967 3:155403582-155403604 GAGATGGCATTTTGTCATGTTGG + Intronic
964647812 3:158977386-158977408 GAAAGTGCAATGTATGATGTGGG + Intronic
968829929 4:2928101-2928123 CAAAGGGCAGCTTGAGATGGGGG - Intronic
968918092 4:3506250-3506272 GAGATGGGATTTTGTGATGTTGG + Intergenic
970397311 4:15681767-15681789 GAATGGGGAATTTGTGAGGTAGG + Exonic
973170783 4:47140662-47140684 GAAAGGGCACTTTCTCATGGTGG - Intronic
974070063 4:57115148-57115170 GCAAGGTCAGGTTGTGGTGTTGG + Intergenic
975228435 4:71902363-71902385 GAAAGGGCAATTTCTGCAGTTGG + Intergenic
975491017 4:74988928-74988950 GAAAGGGCATTTTGTGCTGAAGG + Intronic
978898458 4:113919664-113919686 GAAGGGGCAGTGTGTGAGGTGGG + Intronic
979308879 4:119178791-119178813 GAAACAGCATTTTGTCATGTTGG + Intronic
980089266 4:128425138-128425160 GAAAGGACATTTTGTGACCTTGG + Intergenic
981219801 4:142218159-142218181 GACAGGCCAGTTGGTGATGGTGG + Intronic
981965663 4:150599256-150599278 GAAAGGGGAGTGTGAGATGGAGG - Intronic
982800622 4:159702278-159702300 GAACAGGCAGATTTTGATGTTGG + Intergenic
985411034 4:189684112-189684134 GAAAGGGCAGTGTTTTATATGGG - Intergenic
986106544 5:4665070-4665092 GCAAGGGCTGTTAGTAATGTTGG + Intergenic
986377344 5:7145814-7145836 GAAAGGCCAGTTTGTCTTGTTGG - Intergenic
995060442 5:107807235-107807257 GAGAGGGCAGTAAGTCATGTTGG + Intergenic
995542354 5:113197406-113197428 GAAAAGGCTGTTTGTGGTGATGG + Intronic
996414237 5:123192669-123192691 GGAAGGGCAGGTTGTGTTGGAGG + Exonic
998496318 5:142593100-142593122 GAAATGGAAGTCTGTGATTTCGG - Exonic
1000518317 5:162268225-162268247 GAAAAGTGAATTTGTGATGTTGG + Intergenic
1001214719 5:169845157-169845179 GCAAGGGCAGCTTGAGATCTAGG - Intronic
1003006576 6:2388436-2388458 TAAAGGGAACTTTGTGTTGTTGG + Intergenic
1003271834 6:4614260-4614282 GAGAGGGGAGTTTGATATGTGGG - Intergenic
1004490304 6:16109188-16109210 GAAAGGCCTGCTTGTGAGGTTGG + Intergenic
1005047034 6:21652646-21652668 GCAAGGTCAGTTTGTGGTGAGGG + Intergenic
1006354991 6:33550442-33550464 GAAACGGGATTTTGTCATGTTGG + Intergenic
1006508931 6:34511312-34511334 GAAAATGCAGATTCTGATGTGGG + Intronic
1006924576 6:37647449-37647471 GAAAGGGAATATTGTGAGGTGGG + Intronic
1008826945 6:55707103-55707125 TAAAGGGCAGTTTCTGAAGAGGG + Intergenic
1008879928 6:56371588-56371610 GAAAGGGCAGTTTGAGTAGAGGG + Intronic
1011080675 6:83487233-83487255 GAAAGGGAAATATGTGATTTGGG + Intergenic
1012808078 6:103921232-103921254 GAGAGGGATGTTTGTGATGCTGG - Intergenic
1013179322 6:107705104-107705126 GAGAGTCTAGTTTGTGATGTTGG + Intronic
1013254197 6:108367754-108367776 GAAAGAGCAGCTGGTGAGGTAGG + Intronic
1013473476 6:110486749-110486771 GGAAGGGGAGTTTGTGTGGTGGG + Intergenic
1014661123 6:124173430-124173452 GAAAGGGAAGTTTTTGAGGTAGG - Intronic
1016002404 6:139055497-139055519 GAAAGGGGAGTTTATGTAGTAGG + Intergenic
1016270965 6:142289909-142289931 AAAAGGGTAGTTTCTGATGGTGG + Intergenic
1017982624 6:159414660-159414682 GAAAGGGCAAGTTGAAATGTGGG - Intergenic
1018330746 6:162725428-162725450 GAATGGTCAGTTTGGGATTTGGG - Intronic
1018882481 6:167898578-167898600 CAAAGTGAAGTTTGTGATTTTGG + Intronic
1019346562 7:533644-533666 GAGAGGGCTGTGTGTGATGAGGG + Intergenic
1019428572 7:988372-988394 GAATGGGCACTTTGTGAAGCGGG + Exonic
1020011866 7:4809615-4809637 GAAAGGGCAGGTTGAGCTGAAGG - Intronic
1020844706 7:13268262-13268284 AAAAGGGCATTTTGTGATAATGG - Intergenic
1023278255 7:38543388-38543410 GAAGGGGCTGCTTGTGATGATGG + Intronic
1023669569 7:42561468-42561490 GAAAAGGCAGCTTGTGGAGTTGG + Intergenic
1025581641 7:62726753-62726775 GAGAAAGCAATTTGTGATGTGGG + Intergenic
1029163830 7:98571887-98571909 GAAAGGGCAGAGTGGGATGGAGG - Intergenic
1030698784 7:112615950-112615972 GAAAAGTCAGTTAGTGATGTGGG - Intergenic
1031037714 7:116806325-116806347 CAAAGGGCAGTTTATTATGTTGG - Intergenic
1031737777 7:125388376-125388398 AAAAGGGCAGGTTGGGAAGTTGG + Intergenic
1033062550 7:138122468-138122490 AAAGGGGCAGTTTTTGATTTCGG + Intergenic
1033618838 7:143043591-143043613 GAAAGGACAGTGTGTGAAGTGGG + Intergenic
1034315060 7:150123179-150123201 GAATGTGCAGTTTGTTATGTAGG - Intergenic
1034791833 7:153977603-153977625 GAATGTGCAGTTTGTTATGTAGG + Intronic
1035322054 7:158037363-158037385 GTAAGTGCACTCTGTGATGTTGG - Intronic
1039487840 8:37925672-37925694 GAAGAGGCAGTCTGTGATGCTGG - Intergenic
1041727226 8:61029644-61029666 GAAAGTGCAGTTTGTTACATAGG + Intergenic
1042494396 8:69440073-69440095 GAAAGTGCAGTTTGAGAGGTGGG + Intergenic
1046031769 8:108790615-108790637 TAAAGGGGATTTTGTGGTGTTGG - Intergenic
1046401477 8:113710308-113710330 TAAAAGGCAGTATGTAATGTGGG - Intergenic
1047183884 8:122614633-122614655 GAAAGGGCATGTTGTGCTGAGGG - Intergenic
1049006506 8:139859027-139859049 GAAAGGGCAGCGTCTGCTGTGGG - Intronic
1049116507 8:140693229-140693251 GAAAGGACAGTATCTGATCTGGG + Intronic
1049662207 8:143824535-143824557 GAGAGGGCAGTTTGGGCTGGGGG - Intronic
1051446776 9:17148865-17148887 GAACGTGCAGTTTGTTATGTAGG + Intronic
1051605443 9:18913714-18913736 TAATTGGCAGTATGTGATGTGGG - Intergenic
1055172184 9:73272295-73272317 AAAAAGGCAGTTAGTGAGGTGGG + Intergenic
1055772990 9:79737107-79737129 GAACGTGCAGTGTGTGAGGTGGG - Intergenic
1057457471 9:95227569-95227591 GAATTGGCAGGTTGAGATGTTGG - Intronic
1057763522 9:97895863-97895885 GAAAGGCCAGGCTGGGATGTTGG - Intergenic
1058415551 9:104784974-104784996 GACTGAGCAGTTGGTGATGTAGG - Intronic
1058795184 9:108490869-108490891 GAAAGGGTAGCCTGGGATGTGGG - Intergenic
1060857011 9:126922440-126922462 GCAAGGGAAGTTTGTGCTTTTGG + Intronic
1062108571 9:134769289-134769311 GAAAGGGCAGTTTGTGATGTGGG - Intronic
1062481202 9:136753336-136753358 GAAAGTGCAGTTTCTGGTGAGGG - Intergenic
1203660558 Un_KI270753v1:38102-38124 GAAAGGGCAGTGTTTTATATGGG + Intergenic
1203671729 Un_KI270755v1:21324-21346 GAAAGGGCAGTGTTTTATATGGG + Intergenic
1186287685 X:8063359-8063381 GAAATGGAAGTTTGGGATGCTGG + Intergenic
1188861378 X:35260555-35260577 CAGATGGCAGGTTGTGATGTCGG - Intergenic
1189673704 X:43439510-43439532 GAAAGGGGCCTTTTTGATGTTGG + Intergenic
1190596132 X:52053853-52053875 GAAAGGGCAGTGAGGGATATGGG - Intronic
1190612692 X:52200220-52200242 GAAAGGGCAGTGAGGGATATGGG + Intronic
1190773364 X:53533424-53533446 GAAAGATCAGTTTGTGGTGAGGG + Intronic
1194111982 X:89845466-89845488 GAAAGAGCACAATGTGATGTAGG + Intergenic
1194570670 X:95551047-95551069 GAAAGGTCAGTTTGTACAGTTGG - Intergenic
1195160268 X:102163898-102163920 GTAAGGGCAGTTTCTGAGGGTGG - Intergenic
1196088154 X:111708614-111708636 TAAATGCCAGTTTGTAATGTAGG + Intronic
1196761628 X:119205913-119205935 GAAAGGGCAGTATGTGTCCTGGG + Intergenic
1196931255 X:120684069-120684091 GAAGGGGAAGTTTGTGCTGGTGG - Intergenic
1202018559 Y:20437857-20437879 GAAAGGGCAGTGGGGGATGGTGG + Intergenic
1202179662 Y:22128748-22128770 GAGAGGCCAGTTTGAGGTGTGGG - Intergenic
1202211699 Y:22457646-22457668 GAGAGGCCAGTTTGAGGTGTGGG + Intergenic
1202587177 Y:26443717-26443739 GAAAGGGCATTTGGAGAGGTAGG + Intergenic