ID: 1062108572

View in Genome Browser
Species Human (GRCh38)
Location 9:134769290-134769312
Sequence AGAAAGGGCAGTTTGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 282}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062108572_1062108576 -2 Left 1062108572 9:134769290-134769312 CCACATCACAAACTGCCCTTTCT 0: 1
1: 0
2: 2
3: 26
4: 282
Right 1062108576 9:134769311-134769333 CTTGGTCAGAAGAAGCAGAGTGG No data
1062108572_1062108578 29 Left 1062108572 9:134769290-134769312 CCACATCACAAACTGCCCTTTCT 0: 1
1: 0
2: 2
3: 26
4: 282
Right 1062108578 9:134769342-134769364 CATCCCCACGCGCGCAGCTGTGG No data
1062108572_1062108579 30 Left 1062108572 9:134769290-134769312 CCACATCACAAACTGCCCTTTCT 0: 1
1: 0
2: 2
3: 26
4: 282
Right 1062108579 9:134769343-134769365 ATCCCCACGCGCGCAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062108572 Original CRISPR AGAAAGGGCAGTTTGTGATG TGG (reversed) Intronic
900740426 1:4327671-4327693 GGCAAGGGCAGTGGGTGATGGGG - Intergenic
901077634 1:6565289-6565311 AGAAAGGGCACTTAGTGCTCGGG + Intronic
902556776 1:17251351-17251373 AGAAAGGGCAGTAGGTGTTGTGG + Intronic
905620627 1:39443054-39443076 AGAAAGAGCAGCTTTTGATTGGG + Intronic
906315352 1:44783653-44783675 AGAAGGGTCAGTGTGTGCTGGGG - Exonic
906850574 1:49245465-49245487 AGAAAAGGCAGTCTGTTATTTGG - Intronic
907207659 1:52788120-52788142 AGGAAGGGCAGTGTAGGATGAGG + Intronic
907387585 1:54136112-54136134 TGAAAGGGCCTTTTGTGCTGTGG + Intronic
907629246 1:56063153-56063175 AGCAAAGTCAGATTGTGATGAGG + Intergenic
908155661 1:61350070-61350092 AGAAAGATCAGTCTGTCATGAGG - Intronic
908397843 1:63742621-63742643 AGAAAGGGCATTTTGGGTTAAGG + Intergenic
908730859 1:67225344-67225366 GGAAGGGGCAGTCTGAGATGAGG + Intronic
909980837 1:82098866-82098888 AGAAACGGCAGTTTGGCTTGTGG - Intergenic
910500516 1:87884932-87884954 AGAAAGCGCAGTATGTGAGGAGG + Intergenic
910792829 1:91068904-91068926 AGAAAGGGAAGTTCTTGAAGAGG + Intergenic
910927158 1:92409402-92409424 AGAAAGGTCAGTGTGTGCTGTGG + Intergenic
910985710 1:93002775-93002797 AGAAAGAGCACTTTGTAATATGG - Intergenic
912561395 1:110554246-110554268 AGGAAGGGAAGTTTGTGGAGAGG - Intergenic
912745514 1:112242560-112242582 AGAAAGGCCGGTTTGGGAGGTGG + Intergenic
913058637 1:115184673-115184695 GCAAAGGGCAGTTTGTGAGTAGG - Intergenic
913144383 1:115975852-115975874 ATAAACGGCAGTTTGTCAGGTGG - Intergenic
915163014 1:153932916-153932938 AGAAGGGGCAGGTTGTGTTGAGG + Exonic
915304582 1:154970253-154970275 AGGAAGGGCAGCTGATGATGGGG - Exonic
916032220 1:160887340-160887362 AGAAAAGCCACTTTGAGATGGGG - Intergenic
917095088 1:171392033-171392055 AGAAAGGGAATAGTGTGATGGGG - Intergenic
917375099 1:174343596-174343618 AGAAAGAGCAGTTCTTAATGAGG - Intronic
917579068 1:176355852-176355874 AAAAAGGTCACTTTGTAATGTGG - Intergenic
917969876 1:180199691-180199713 GGCAAGGACAGGTTGTGATGAGG + Exonic
919030329 1:192234206-192234228 ATAAAAGGCATTTTATGATGTGG + Intergenic
919192207 1:194236649-194236671 AGAAAGAGCATTTTATGAAGTGG - Intergenic
919907164 1:202085932-202085954 AGAAGGGGCACGTTGGGATGGGG + Intergenic
920285946 1:204879865-204879887 ATAAAGGGCAATTTCTGATCTGG + Intronic
920700677 1:208216097-208216119 AGAAAGAGCAGCAGGTGATGGGG - Intronic
921102544 1:211942421-211942443 AGAAAGGCCAGCATGTGAAGGGG - Intronic
922061883 1:222100685-222100707 AGAGAGAGTAGTATGTGATGAGG - Intergenic
922177043 1:223204892-223204914 AGAAAGGCCAGTTTTGGGTGTGG + Intergenic
923480240 1:234376992-234377014 AGCATGGTCAGTTTGTGATGAGG + Intronic
1063536538 10:6889661-6889683 ACTAAGGGCAGTCTGTGATCCGG - Intergenic
1064468516 10:15611369-15611391 ATAAAGTGCAATTTGTTATGTGG - Intronic
1068333326 10:55600717-55600739 TGTAAGGGCACTTTGTGAAGTGG - Intronic
1069820487 10:71224627-71224649 TGAAATTGCAGTTAGTGATGGGG - Intronic
1072429458 10:95357930-95357952 AGAAAGGACAGTTCTTGATTAGG - Intronic
1073441400 10:103554953-103554975 AGATGGGGCTGTGTGTGATGGGG + Intronic
1073780950 10:106837881-106837903 AGGAAGGGCAGAGTGTGCTGAGG - Intronic
1075485700 10:122820467-122820489 AGAAAGAACAGGCTGTGATGGGG + Intergenic
1075637867 10:124042590-124042612 AGAAAGGGCTGCTGGGGATGGGG + Intronic
1076979445 11:196853-196875 GGAAAGGACAGTCTCTGATGAGG + Exonic
1077166406 11:1141416-1141438 GGAAGGGGCAGCTTGTGGTGTGG - Intergenic
1079185615 11:18233125-18233147 GGAATGGGCAGTACGTGATGAGG + Intronic
1079799991 11:24857048-24857070 TACAAGGGCAGTTTGTTATGTGG - Intronic
1080584932 11:33673192-33673214 AAAATGGGAAGTTTGTGATATGG + Exonic
1080760772 11:35246779-35246801 TGAAAGGGAAGTTTGGGATCAGG + Intergenic
1083866165 11:65454628-65454650 AGAAAGGGCAAATTCTGATTTGG + Intergenic
1084365582 11:68695701-68695723 AGAGAGGGCAGCTTTTGTTGGGG - Intergenic
1087151334 11:94862179-94862201 AGAAGGGGTAGTCTGTAATGGGG - Intronic
1087542290 11:99534990-99535012 AGAAAGAGCACTATGTGTTGAGG + Intronic
1088545867 11:110958134-110958156 AGAAAGCACAGTTTTTGATTAGG - Intergenic
1088843488 11:113646026-113646048 AGAAATTCCAGCTTGTGATGAGG + Intergenic
1089640576 11:119844907-119844929 AGAAATGGCAGTGGGGGATGGGG - Intergenic
1089852516 11:121512666-121512688 AGAAAGAGGATTGTGTGATGAGG - Intronic
1089979228 11:122758498-122758520 GGAAAGGGCAGTCAGTGGTGGGG + Intronic
1089981594 11:122777183-122777205 AGAACTGGCAGAGTGTGATGTGG - Exonic
1090174799 11:124638971-124638993 ATAAAGGGCAGGTTGGGAGGAGG + Intronic
1091316404 11:134617141-134617163 AGAAAGAGCATTTTCAGATGAGG + Intergenic
1091578193 12:1759602-1759624 ATAAAGGGCAATATGTGATCAGG - Intronic
1092755925 12:11763223-11763245 AGAGAGGGGACTTTGTGAGGTGG - Intronic
1093558550 12:20509042-20509064 AAGAAGGGCAGTTTGAGATACGG - Intronic
1094634302 12:32209781-32209803 AGAAAGGGCAGTCAGGGAAGAGG - Intronic
1096747300 12:53737431-53737453 AGCTGGGGGAGTTTGTGATGAGG + Intergenic
1099204003 12:79707622-79707644 TGTGAGGGCAGTTTGTGGTGGGG + Intergenic
1102467679 12:113139503-113139525 AGCAAAGGCAGTGTGTGTTGGGG - Intergenic
1102491436 12:113291718-113291740 AGCAGGGGCAGCTGGTGATGTGG - Intronic
1103743800 12:123108792-123108814 AGATAGGGCACGTTGTGATGGGG - Intronic
1103970050 12:124664877-124664899 TGGAAGGGCAGTGTGTGAAGAGG - Intergenic
1104054094 12:125216199-125216221 AGCAAGGTCAGTTTTTGGTGAGG + Intronic
1104102607 12:125627806-125627828 AGGAAGGGCAGTGGGTGCTGTGG - Intronic
1104731749 12:131108980-131109002 AGAAGGGGCAGGTGGGGATGGGG + Intronic
1105806817 13:23956418-23956440 AGGAAGGGCATTTAGTGAGGAGG + Intergenic
1105819986 13:24071730-24071752 AGTAAGGGCATTTAGTGAGGAGG + Intronic
1106231617 13:27825280-27825302 AGCAATGGCAGCTTCTGATGTGG + Intergenic
1106499460 13:30313482-30313504 AGGAAGAGCAGCTTGTGATCAGG + Intergenic
1106648550 13:31664056-31664078 ATAAAGGGTGGTATGTGATGGGG - Intergenic
1108315547 13:49233611-49233633 AGATAGGGCATTTTTTGAGGCGG - Intergenic
1108581545 13:51832543-51832565 GGAAAGGGCAGTTTGGAAAGAGG - Intergenic
1110539241 13:76689258-76689280 AGCATGGTCAGTTTCTGATGAGG + Intergenic
1111567654 13:90037285-90037307 ATTAAGGGCAGGTTGAGATGAGG - Intergenic
1114882547 14:26804754-26804776 AAAAATGTCAGTTTGTGAAGGGG + Intergenic
1116177160 14:41486226-41486248 AAAATGGGCAGTGTGTGAAGAGG + Intergenic
1116508536 14:45715283-45715305 AGAACGGGAAGTTTTTGATCAGG - Intergenic
1117325818 14:54668059-54668081 ACAATGGGCAGTTTTTGAGGCGG - Intronic
1117910562 14:60634468-60634490 AGAAAGAGCACTTTATGCTGAGG - Intergenic
1118317880 14:64736886-64736908 AGAAAGGTGAGTGTGTGAGGTGG + Exonic
1118473784 14:66098890-66098912 AGAAAGGGCTGTCTGCGAAGAGG - Intergenic
1119546400 14:75475004-75475026 AGAATTAGCGGTTTGTGATGAGG - Intergenic
1119672458 14:76529984-76530006 AGCAAGGGCAGTGTGTGTGGTGG - Intergenic
1119922660 14:78460512-78460534 AGAAATGGCATTTTGGGAGGGGG + Intronic
1121030444 14:90654161-90654183 AGAGAAGGGAGTTTGTGATTGGG + Intronic
1121087851 14:91160161-91160183 GGAAAGGGTAGGATGTGATGTGG + Intronic
1121234095 14:92379801-92379823 AGAAAGGTCAGTGTGCGATGGGG - Intronic
1124468034 15:29957383-29957405 GAAAAGGGGAGTTTGGGATGAGG - Intronic
1124479330 15:30064207-30064229 AGGAAGGGCAGTGGGTGATGGGG + Intergenic
1125891256 15:43268811-43268833 AGAAGGGAAAGTCTGTGATGGGG - Intergenic
1127726898 15:61759219-61759241 AGAAAGGATACTTTGTGCTGGGG - Intergenic
1128622049 15:69159478-69159500 AGAAAGGGCACTTCTTGCTGTGG + Intergenic
1129987527 15:79931479-79931501 AGAAAGGGGAGTTTCTTAGGGGG + Intergenic
1133807271 16:9135078-9135100 TGAAAGGGCCGTTTGTTTTGTGG + Intergenic
1134137390 16:11686906-11686928 AGAAAGTGCTATTTGTGTTGAGG - Intronic
1134754972 16:16658965-16658987 AGAAATGGCTGTTTGTGGTCTGG - Intergenic
1134991091 16:18700184-18700206 AGAAATGGCTGTTTGTGGTCTGG + Intergenic
1135684316 16:24486047-24486069 GGAAAGGGCAGGTAGAGATGTGG + Intergenic
1137514097 16:49127585-49127607 AGAAAGGATAGTGTGAGATGGGG + Intergenic
1137920783 16:52486259-52486281 AGAAAGGGCAGCAAGGGATGTGG + Intronic
1138951840 16:61921469-61921491 AGAAAGCTCAGATTTTGATGTGG - Intronic
1139264706 16:65627993-65628015 AGAAAGAGCAGCTTGTGAGAAGG + Intergenic
1139532991 16:67552575-67552597 AGAGGGGGCAGTTAGAGATGAGG + Intergenic
1139665746 16:68454203-68454225 TGAAAGGCCAGTTTGTTATATGG + Intergenic
1139754443 16:69131964-69131986 AGAAAGGGGAGTTCGGGGTGGGG - Intronic
1141446445 16:84061683-84061705 AGAAAGGGCAATTTGTTTTCAGG + Intronic
1143331300 17:6137886-6137908 AGAAAGGGCAGATGGTGAGCAGG + Intergenic
1144386830 17:14755875-14755897 AGGAAGGGCATTTTGGGCTGAGG - Intergenic
1144433448 17:15217518-15217540 AGAAATGGCAGCTTGCAATGTGG + Intergenic
1144461308 17:15460754-15460776 GGAAAGGGATGTTTGTGTTGGGG - Intronic
1145985371 17:29042573-29042595 AGAAAGGGCAGAGTGAGAGGAGG - Intronic
1147259592 17:39201131-39201153 ACAAAGGGCAGGTCTTGATGGGG + Intronic
1147459208 17:40557805-40557827 AGATAGGGCAGGATGTGGTGGGG - Intronic
1147600749 17:41743810-41743832 AGCCAGGACAGGTTGTGATGGGG + Intergenic
1147609246 17:41792038-41792060 ACAAAGGGCAGTTATTGCTGGGG + Intergenic
1148550395 17:48546807-48546829 AGAAAGGGGAGTTGGAGGTGGGG + Intergenic
1148584222 17:48765918-48765940 TGAAAGAGCAGTTTATCATGTGG - Intronic
1150059445 17:62052357-62052379 ATAAAGGGAAGTTTGTAAAGTGG + Intronic
1154335333 18:13460646-13460668 AAAAAGGACAATTAGTGATGAGG + Intronic
1154395540 18:13984556-13984578 AGAAAGGGAAGTATATGAAGGGG - Intergenic
1155122981 18:22841816-22841838 GGAAAGGGCAGCTTCTGAGGGGG - Intronic
1156257644 18:35412720-35412742 AGAAAGGGCAGGAAGAGATGGGG + Intergenic
1156473662 18:37392825-37392847 GGAAGGGGCTGTTTGAGATGTGG - Intronic
1156603528 18:38638983-38639005 ATATAGGGAATTTTGTGATGAGG + Intergenic
1157285086 18:46372254-46372276 AGAGAGCCCAGTTTGAGATGTGG + Intronic
1158047146 18:53169942-53169964 TGGAAGGGCAGTTTATTATGTGG - Intronic
1158779500 18:60629763-60629785 AAAAAGGGCAGTTTGACTTGAGG - Intergenic
1159426639 18:68297348-68297370 AGAAAGGGCAGTTTGGAGCGTGG + Intergenic
1159871097 18:73760283-73760305 ATCCAGGGCAGTTTGTGTTGAGG - Intergenic
1160541392 18:79625675-79625697 AGAAAGGAGAGTTTGTGCTACGG + Intergenic
1164520888 19:28978317-28978339 AGAAAGGGCAGTTGGAGAAGTGG + Intergenic
1165046302 19:33107728-33107750 AGGAAGCGCAGTGTGTGATGGGG - Intronic
1165258104 19:34592180-34592202 AGAAAGGGCATTTTGGGCAGTGG + Intergenic
1165933452 19:39375115-39375137 ACAAAGGGGAGTTTGGGAGGAGG + Intronic
1166194217 19:41195502-41195524 AGAAAGGTCAGGGTGGGATGGGG + Intronic
926001370 2:9335725-9335747 AGCAGGGACAGTTTGTGTTGTGG + Intronic
926456179 2:13070899-13070921 GGAAAGGGGAATTTGTGACGGGG + Intergenic
927444178 2:23143169-23143191 AGCAGGGCCAGTTTCTGATGAGG + Intergenic
928592856 2:32835027-32835049 ATGAAGGGCAGATTGTGATGTGG + Intergenic
929673353 2:43898041-43898063 GGAAAAGGCAGTTTATGATAGGG - Intronic
929752435 2:44729756-44729778 AGAAAGGGAAATATTTGATGAGG + Intronic
932287141 2:70544869-70544891 AGAAAGGGTAGTGGGTGGTGTGG + Intronic
933258789 2:80108997-80109019 TCAAAGGGAAGTATGTGATGAGG - Intronic
933726158 2:85428641-85428663 ATAAAGGTTGGTTTGTGATGCGG - Intronic
933750466 2:85599713-85599735 AGAAGGGCCAGTTGGTGATGTGG + Intronic
934514213 2:94974757-94974779 AGGAAGTGCTGGTTGTGATGGGG + Intergenic
935943645 2:108267556-108267578 GGGAAGGGCAGTTTCTGCTGTGG - Intergenic
936451522 2:112637040-112637062 AGAAAGTGCAGGTTGGGAGGAGG + Intergenic
938060431 2:128250490-128250512 AGAAGGGGCCTTTTGTAATGTGG + Intronic
941187790 2:162339061-162339083 AGAAAGGTCAGTTTGCCAAGTGG + Intronic
944740699 2:202609376-202609398 AGAAGGGGAAGTTTGGGTTGAGG + Intergenic
946324023 2:218973898-218973920 AGAAAGGGCAGTGCAGGATGCGG - Intergenic
946782537 2:223205928-223205950 AGAAATGGCAGTGGGTGAAGCGG - Intergenic
948274951 2:236701176-236701198 AGGGAGGGCAGTGTGTGATTTGG + Intergenic
948637979 2:239352365-239352387 TGAAAGGTCAGGTTGTGATGTGG - Intronic
1170855685 20:20052146-20052168 AGGAAGGGCAGCTGGTGGTGGGG - Intronic
1171360117 20:24581627-24581649 CGACAGGGCCGTGTGTGATGAGG + Intronic
1171988901 20:31680411-31680433 AGAAAGGGAAGAGTGTGCTGAGG + Intronic
1174130287 20:48339760-48339782 AGAGAGAGAGGTTTGTGATGAGG - Intergenic
1175699870 20:61129135-61129157 AGAAAGGGCAGAATCAGATGTGG - Intergenic
1176665542 21:9683660-9683682 AGAAAGGGCAGTGTTTTATATGG - Intergenic
1177216095 21:18131024-18131046 AGAATGGTCAGTTTCTGGTGAGG + Intronic
1177389868 21:20454105-20454127 CGAAATGGTAGTTTGTGCTGTGG + Intergenic
1177690121 21:24494955-24494977 AGATAGCGCAGGTTGGGATGGGG - Intergenic
1178123343 21:29491884-29491906 AAAAAGAGCAGTTTTTGAAGGGG - Intronic
1178262118 21:31109177-31109199 ATAAAGGCTAGTTTGTCATGTGG - Intergenic
1178398419 21:32262870-32262892 AGGGAGGGGAGTTTGGGATGAGG - Intergenic
1180501527 22:15934199-15934221 AGAAAGAGATGTTTGTGTTGTGG - Intergenic
1181560914 22:23699024-23699046 AGCAGGAGCAGTTGGTGATGAGG - Exonic
1182223072 22:28773609-28773631 AGAAAGGGACGTTTGGTATGTGG + Intronic
1182663547 22:31942098-31942120 GGATAGGGCAGTGTGTGAAGAGG + Intronic
1182811435 22:33120304-33120326 AGAAAAGGCAGTTTATGATGTGG - Intergenic
1183143913 22:35971735-35971757 AGTAAGGGCTGTTTCTGATTAGG + Intronic
949243880 3:1902637-1902659 AGAAAGGGCACTTTGAGAAAGGG + Intergenic
949616822 3:5762810-5762832 AGGAAGAGGAGTTTGGGATGTGG + Intergenic
950033060 3:9864471-9864493 AGAAAAGGCAGCCTCTGATGAGG - Intergenic
950912757 3:16611899-16611921 ATAAAGGGCTGGTTTTGATGGGG + Intronic
954716139 3:52527836-52527858 TGAAAGGACTGTTGGTGATGAGG + Exonic
956084441 3:65595463-65595485 AGAAGAGGCAATTTGTGAGGTGG - Intronic
956114494 3:65904598-65904620 AGAAAGGGCATTCTGGGCTGAGG - Intronic
956215082 3:66840398-66840420 ACTAAGGGCAGGCTGTGATGGGG - Intergenic
957341216 3:78899218-78899240 AGTAAGTGCATTTTGTGAAGTGG + Intronic
957977967 3:87471895-87471917 AAAAAGGGCACTTTGTGGTGTGG + Intergenic
960496379 3:118380414-118380436 TAAAAGGGCAGTTTGAGAAGTGG + Intergenic
963331265 3:143919031-143919053 AGAAAGGGCAGTGAGGGATGAGG + Intergenic
963374468 3:144446244-144446266 AGAAAGGTAAGTGTGAGATGAGG + Intergenic
964092706 3:152895118-152895140 AGAAGTGGTAGTTTGTGCTGAGG + Intergenic
964323648 3:155523944-155523966 GGAAGGGGAAGTTTCTGATGAGG - Exonic
964647811 3:158977385-158977407 AGAAAGTGCAATGTATGATGTGG + Intronic
965137961 3:164798668-164798690 GGGAAGGACAGTATGTGATGAGG - Intergenic
965564377 3:170097083-170097105 AGAAATGTCAGTATTTGATGTGG + Exonic
966971562 3:185049782-185049804 AGAAAGGGGAGTGCGTGAAGGGG - Intronic
967875038 3:194262814-194262836 AGAAAGAGCAGTTTGAGAGGCGG + Intergenic
968829930 4:2928102-2928124 TCAAAGGGCAGCTTGAGATGGGG - Intronic
970513301 4:16802131-16802153 AGATGGGGCAGTTGGTGATGGGG - Intronic
970855449 4:20645911-20645933 AGAAAGGGGAGTTGGAGCTGAGG - Intergenic
972066390 4:34951130-34951152 AGACAGTGCTGTTTGTTATGTGG + Intergenic
975281185 4:72564753-72564775 AGAGAAGGCAGTTTGTGATGGGG - Intronic
976112136 4:81687082-81687104 AGAAAGGCCACTGTGTGATGAGG - Intronic
977719656 4:100224385-100224407 AGAAAGGGGAGTCTGTCATTAGG + Intergenic
978397446 4:108296545-108296567 AGAAAGGGCACTAAGTGATTAGG + Intergenic
978441323 4:108737278-108737300 AAACAGGGCACTTTGTGAAGAGG - Intergenic
978838403 4:113181563-113181585 AGAAAAGGCAGTAAGTGATATGG + Intronic
978898457 4:113919663-113919685 GGAAGGGGCAGTGTGTGAGGTGG + Intronic
978971944 4:114819133-114819155 AGATAGAGCAGTATGTGGTGGGG - Intergenic
983080595 4:163380748-163380770 AAAAAGGGAAGTTTGGCATGAGG + Intergenic
983349031 4:166563082-166563104 AGAAAAGGCAGTTTTTTGTGTGG + Intergenic
983510883 4:168608605-168608627 AGAAAAGACAGTTTGTGGGGAGG - Intronic
985411035 4:189684113-189684135 AGAAAGGGCAGTGTTTTATATGG - Intergenic
986579960 5:9255600-9255622 AGAAGGAGCAGCTAGTGATGAGG - Intronic
986648131 5:9938512-9938534 AGAAAGGTCAGGTTGGGTTGGGG + Intergenic
986932371 5:12842175-12842197 AGAAAGGGCAGTAGGTGTGGAGG + Intergenic
988431500 5:31124269-31124291 AGAAAGTGTGGTGTGTGATGAGG + Intergenic
992173266 5:74124680-74124702 AGAAAGATCCGTTTCTGATGGGG + Intergenic
992573793 5:78090176-78090198 AGGAAGGGCTGTTTGGGCTGGGG - Intronic
998559566 5:143158721-143158743 AGTAAAGGCAGCTGGTGATGGGG + Intronic
999736133 5:154514705-154514727 ATACATGGCAGTTTGTGCTGAGG - Intergenic
1000925891 5:167193493-167193515 AGAAAGGGCAGGGTGGGGTGGGG + Intergenic
1001211670 5:169815526-169815548 AGGAAGGGCAGAATGTAATGGGG + Intronic
1001248111 5:170120877-170120899 AGAATGGTCAGTTTCTGGTGAGG + Intergenic
1003605507 6:7556579-7556601 AGAAGGGGTACTTTGTGAAGAGG - Intronic
1003766640 6:9244751-9244773 ACACAGGGCAGGTTGTAATGTGG + Intergenic
1003909107 6:10727334-10727356 AAAAAGGGAAGTTTATGAAGGGG - Intronic
1004770545 6:18776267-18776289 AGACAGGGCAATTTGTCGTGAGG + Intergenic
1005047033 6:21652645-21652667 GGCAAGGTCAGTTTGTGGTGAGG + Intergenic
1006020391 6:31114468-31114490 AGAAAGTGGAGTGTGTGGTGGGG - Intergenic
1006924575 6:37647448-37647470 AGAAAGGGAATATTGTGAGGTGG + Intronic
1008462462 6:51791315-51791337 TCAAAGGGCTGTATGTGATGGGG - Exonic
1008826944 6:55707102-55707124 TTAAAGGGCAGTTTCTGAAGAGG + Intergenic
1008879927 6:56371587-56371609 GGAAAGGGCAGTTTGAGTAGAGG + Intronic
1010578581 6:77565201-77565223 AGAAAAGGCATTTTTTTATGAGG - Intergenic
1010736359 6:79448330-79448352 AGCATGAGCAGTGTGTGATGGGG + Intergenic
1011080674 6:83487232-83487254 AGAAAGGGAAATATGTGATTTGG + Intergenic
1013473447 6:110486517-110486539 AGAAAGGCCAGGCTGAGATGAGG - Intergenic
1014993278 6:128108794-128108816 AGCAAGGGCAGGTTCTGATGAGG + Intronic
1015817643 6:137226818-137226840 AGAAAGGGCACTCTGTAATGTGG - Intergenic
1016014554 6:139170594-139170616 AAGAAGGGCAGGTTGCGATGAGG + Intronic
1016386291 6:143533931-143533953 AGAGAAGGCAGCTTGTGAAGGGG + Intergenic
1017767179 6:157616350-157616372 AGAAGAGGCAGCTTGTGAGGAGG + Intronic
1018194820 6:161346116-161346138 AGTAAGGGCAGATGGAGATGAGG + Intergenic
1019114414 6:169747512-169747534 AGAAAGGACATTTAGAGATGTGG - Intronic
1019346561 7:533643-533665 GGAGAGGGCTGTGTGTGATGAGG + Intergenic
1019428571 7:988371-988393 CGAATGGGCACTTTGTGAAGCGG + Exonic
1021239008 7:18177841-18177863 ATAAAGGGCACTTTGTGAGGAGG + Intronic
1025581640 7:62726752-62726774 AGAGAAAGCAATTTGTGATGTGG + Intergenic
1027984645 7:85271769-85271791 AGAAAAGGCAGCCTGAGATGAGG - Intergenic
1030698785 7:112615951-112615973 TGAAAAGTCAGTTAGTGATGTGG - Intergenic
1030746997 7:113178355-113178377 AGAGAGGGGAGTTTCAGATGAGG - Intergenic
1031798994 7:126218827-126218849 AGAGAGGACAGTTAGTGAGGAGG - Intergenic
1031953741 7:127920552-127920574 AAAAGGGACAGTTTGGGATGAGG + Intronic
1033618837 7:143043590-143043612 GGAAAGGACAGTGTGTGAAGTGG + Intergenic
1034891712 7:154845469-154845491 AGAGAGGGCAGTTTGTAGTCAGG + Intronic
1034953046 7:155313817-155313839 ATGAAGAGCAGTGTGTGATGAGG - Intergenic
1036683374 8:10892335-10892357 ACAATGGGCAGTTTGGGCTGAGG + Intergenic
1039842751 8:41305518-41305540 AGAAAGAGAAATGTGTGATGCGG + Intronic
1040512680 8:48108817-48108839 GGAAAAGCCAGTTTGTTATGAGG + Intergenic
1041565692 8:59275622-59275644 GGAAAGGGAAGTCTGTGAGGTGG + Intergenic
1041819280 8:62011088-62011110 GGATAGGGCACATTGTGATGAGG + Intergenic
1042494395 8:69440072-69440094 GGAAAGTGCAGTTTGAGAGGTGG + Intergenic
1043238838 8:77904892-77904914 AAAAAGGTCATTTTGTAATGGGG - Intergenic
1044034678 8:87285795-87285817 AGGAAGTGGAGTTTGTGGTGAGG + Intronic
1045239753 8:100389096-100389118 AGAAAGGGCAGTGAATCATGGGG + Intronic
1046034605 8:108825491-108825513 TAAAAGGGCACTTGGTGATGAGG + Intergenic
1046260960 8:111766577-111766599 AGAAAGAACGATTTGTGATGAGG + Intergenic
1046762583 8:118036789-118036811 AGAAAGGGCAGTAGATGGTGGGG - Intronic
1046810273 8:118525587-118525609 AGAATGGGCAGTTTGGTATGAGG - Intronic
1047183885 8:122614634-122614656 GGAAAGGGCATGTTGTGCTGAGG - Intergenic
1049116506 8:140693228-140693250 AGAAAGGACAGTATCTGATCTGG + Intronic
1049662208 8:143824536-143824558 AGAGAGGGCAGTTTGGGCTGGGG - Intronic
1051716372 9:19988812-19988834 TGAAAGGGGAGTGTGTGATTTGG - Intergenic
1055146949 9:72947268-72947290 TGAAAGGAAAGTTTCTGATGTGG + Intronic
1055172183 9:73272294-73272316 AAAAAAGGCAGTTAGTGAGGTGG + Intergenic
1056443501 9:86642829-86642851 AGAAAGGGCATTCTGAGAGGAGG - Intergenic
1058739511 9:107929227-107929249 AGCATGGGCAGGTTCTGATGAGG - Intergenic
1059241479 9:112810056-112810078 AGGAAGGGAAGTTTGTTTTGTGG + Intronic
1060822202 9:126667991-126668013 AGAAAGTGCAGGTGATGATGTGG + Intronic
1062108572 9:134769290-134769312 AGAAAGGGCAGTTTGTGATGTGG - Intronic
1062481203 9:136753337-136753359 GGAAAGTGCAGTTTCTGGTGAGG - Intergenic
1203660557 Un_KI270753v1:38101-38123 AGAAAGGGCAGTGTTTTATATGG + Intergenic
1203671728 Un_KI270755v1:21323-21345 AGAAAGGGCAGTGTTTTATATGG + Intergenic
1186277288 X:7953373-7953395 AGAAAGGGCTGTCACTGATGAGG - Intergenic
1186624251 X:11275504-11275526 GGAAAGGACAGTTTTTAATGAGG - Intronic
1188000254 X:24973835-24973857 AGAAAGGGAAGCTTGTGTGGGGG - Intronic
1189715085 X:43857058-43857080 AGAATAGGTAGTTTGTGTTGAGG - Intronic
1190596133 X:52053854-52053876 AGAAAGGGCAGTGAGGGATATGG - Intronic
1190612691 X:52200219-52200241 AGAAAGGGCAGTGAGGGATATGG + Intronic
1190773363 X:53533423-53533445 AGAAAGATCAGTTTGTGGTGAGG + Intronic
1192536423 X:71932335-71932357 AGAAAGAGCAGCATGAGATGAGG + Intergenic
1195012338 X:100744962-100744984 GCAAAGGGCAGTTTGGGCTGAGG + Intergenic
1195148858 X:102044776-102044798 AGAAAGGGCAGTTCCTGCAGAGG - Intergenic
1195377957 X:104245742-104245764 AGAAAGACGAGTGTGTGATGAGG + Intergenic
1195638096 X:107141154-107141176 AGAAAAGGAAGTTTGGGAAGTGG + Intronic
1195758698 X:108223996-108224018 TGAGAGAGCAGGTTGTGATGTGG + Intronic
1196761627 X:119205912-119205934 AGAAAGGGCAGTATGTGTCCTGG + Intergenic
1197636065 X:128916173-128916195 AAAAAGTGGAGTTTGTGATTAGG - Intergenic
1198623291 X:138538153-138538175 AGAAAGGGGAGGGTGGGATGGGG - Intergenic
1198652179 X:138874944-138874966 AGAAAGTGCAGCTTGTGACTGGG + Intronic
1202369397 Y:24186828-24186850 AGCAAGGGCTGTCTGTGATGTGG + Intergenic
1202501388 Y:25483289-25483311 AGCAAGGGCTGTCTGTGATGTGG - Intergenic