ID: 1062108576

View in Genome Browser
Species Human (GRCh38)
Location 9:134769311-134769333
Sequence CTTGGTCAGAAGAAGCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062108569_1062108576 9 Left 1062108569 9:134769279-134769301 CCCAGTGACTCCCACATCACAAA 0: 1
1: 0
2: 0
3: 23
4: 209
Right 1062108576 9:134769311-134769333 CTTGGTCAGAAGAAGCAGAGTGG No data
1062108572_1062108576 -2 Left 1062108572 9:134769290-134769312 CCACATCACAAACTGCCCTTTCT 0: 1
1: 0
2: 2
3: 26
4: 282
Right 1062108576 9:134769311-134769333 CTTGGTCAGAAGAAGCAGAGTGG No data
1062108566_1062108576 30 Left 1062108566 9:134769258-134769280 CCCTCAGGCCGAGTCAGTTGGCC 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1062108576 9:134769311-134769333 CTTGGTCAGAAGAAGCAGAGTGG No data
1062108567_1062108576 29 Left 1062108567 9:134769259-134769281 CCTCAGGCCGAGTCAGTTGGCCC 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1062108576 9:134769311-134769333 CTTGGTCAGAAGAAGCAGAGTGG No data
1062108570_1062108576 8 Left 1062108570 9:134769280-134769302 CCAGTGACTCCCACATCACAAAC 0: 1
1: 0
2: 0
3: 25
4: 196
Right 1062108576 9:134769311-134769333 CTTGGTCAGAAGAAGCAGAGTGG No data
1062108568_1062108576 22 Left 1062108568 9:134769266-134769288 CCGAGTCAGTTGGCCCAGTGACT 0: 1
1: 0
2: 2
3: 9
4: 109
Right 1062108576 9:134769311-134769333 CTTGGTCAGAAGAAGCAGAGTGG No data
1062108571_1062108576 -1 Left 1062108571 9:134769289-134769311 CCCACATCACAAACTGCCCTTTC 0: 1
1: 0
2: 1
3: 27
4: 209
Right 1062108576 9:134769311-134769333 CTTGGTCAGAAGAAGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062108576 Original CRISPR CTTGGTCAGAAGAAGCAGAG TGG Intronic
No off target data available for this crispr