ID: 1062109873

View in Genome Browser
Species Human (GRCh38)
Location 9:134776455-134776477
Sequence ACTTGGAAGCAGAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062109867_1062109873 21 Left 1062109867 9:134776411-134776433 CCTATCTGATTAAAATTCATTCA 0: 1
1: 0
2: 1
3: 33
4: 391
Right 1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062109873 Original CRISPR ACTTGGAAGCAGAGGGTGGA AGG Intronic
No off target data available for this crispr