ID: 1062110782

View in Genome Browser
Species Human (GRCh38)
Location 9:134781000-134781022
Sequence CCCCGCAGGCCGCCGTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062110782_1062110790 3 Left 1062110782 9:134781000-134781022 CCTGGCCACGGCGGCCTGCGGGG 0: 1
1: 0
2: 1
3: 22
4: 302
Right 1062110790 9:134781026-134781048 GAGTGCGGGTGCTGGCGTGATGG No data
1062110782_1062110789 -5 Left 1062110782 9:134781000-134781022 CCTGGCCACGGCGGCCTGCGGGG 0: 1
1: 0
2: 1
3: 22
4: 302
Right 1062110789 9:134781018-134781040 CGGGGCTGGAGTGCGGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062110782 Original CRISPR CCCCGCAGGCCGCCGTGGCC AGG (reversed) Intronic
900100776 1:961120-961142 CCCCGGAGCGCGCCGTGTCCAGG - Intronic
900244563 1:1631248-1631270 CCCCGCGGGACGCCGGTGCCCGG + Intergenic
900291693 1:1926421-1926443 CCCCGCAGGCCGCCTGAGCTGGG + Intronic
900345118 1:2206876-2206898 CCAGGCAGGAGGCCGTGGCCTGG - Intronic
900497549 1:2982876-2982898 CCCAGCAGGCCCGCGTGGCCTGG - Intergenic
900659548 1:3775743-3775765 CCCCTCATGCGGCCCTGGCCTGG + Intronic
902451356 1:16498910-16498932 CCCTGCAGGCCGCTGCGCCCAGG + Intergenic
902472463 1:16658317-16658339 CCCTGCAGGCCGCTGCGTCCGGG + Intergenic
902486341 1:16749129-16749151 CCCTGCAGGCCGCTGCGTCCGGG - Intronic
902690543 1:18107965-18107987 GCCCCCATGCCGCCGCGGCCAGG - Exonic
905296168 1:36955856-36955878 CCCCGCTGGCCACCAGGGCCAGG + Intronic
905631466 1:39521390-39521412 CCCAGCAGGCCGGCCAGGCCAGG - Exonic
905666288 1:39764781-39764803 CCCAGCAGGCCGGCCAGGCCAGG + Exonic
906036006 1:42750710-42750732 CCCGGCCGGCCGCCCTGTCCGGG + Intronic
914048283 1:144108353-144108375 CCTCCCAGGCCACCGTGGACTGG - Intergenic
914130901 1:144857095-144857117 CCTCCCAGGCCACCGTGGACTGG + Intergenic
914889867 1:151612637-151612659 CCCCTCAGGCCTCCGCAGCCGGG + Intronic
915141663 1:153771989-153772011 CACTGCAGACCGCCATGGCCTGG - Intronic
915616890 1:157045937-157045959 CCCCTCACGCCGCGGCGGCCGGG + Intergenic
916802247 1:168226202-168226224 CCCCGCAGGCTTCCCAGGCCCGG - Intronic
917906025 1:179587850-179587872 GCACGCAGGCCGACGTGGCTTGG - Intergenic
918046025 1:180941491-180941513 CCCCGCCAGCCGCCCAGGCCTGG + Intronic
918388836 1:184037361-184037383 CCCCGCCGCCCGCCTCGGCCCGG - Exonic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
922602951 1:226870815-226870837 CCGCGCTGGCCGCAGAGGCCAGG - Intronic
922787859 1:228292085-228292107 CCCCGGCGTCCGCCATGGCCAGG - Exonic
924421876 1:243917351-243917373 TCCCGCGGGCCCCCGAGGCCGGG + Intergenic
1062774592 10:135170-135192 CCCCGCAGGCCCGCGGCGCCAGG + Intronic
1063133395 10:3197084-3197106 CCCCACAGGCCCCAGTGGGCGGG - Intergenic
1066476558 10:35752671-35752693 CCCAGCTGGCCCACGTGGCCTGG - Intergenic
1067464756 10:46489457-46489479 CCCCGCAGTCCTCCGTCCCCAGG + Intergenic
1067622438 10:47895196-47895218 CCCCGCAGTCCTCCGTCCCCAGG - Intergenic
1068523885 10:58106377-58106399 CCCCGCAGGCAGGGCTGGCCAGG + Intergenic
1068668070 10:59697077-59697099 CCCCGCCAGCCGCCCTGTCCGGG + Intronic
1072683065 10:97520679-97520701 ACCAGCAGGCAGCCCTGGCCAGG - Intronic
1073292851 10:102421800-102421822 TCCCGCGGGCCGCATTGGCCCGG + Exonic
1074530790 10:114297457-114297479 CCCAGCAGGGCTCCCTGGCCTGG - Intronic
1074543752 10:114386693-114386715 CCCAGCAGGCCCTCCTGGCCAGG + Intronic
1075040635 10:119104399-119104421 CCCCACAGGCGGCCGCGGGCGGG - Intronic
1076198791 10:128541079-128541101 CCGTGCAGGCCGGCGTGACCCGG + Intergenic
1076207216 10:128612846-128612868 CCCCACAGGCCGCGGTGGCCAGG - Intergenic
1076314397 10:129530729-129530751 GCCCTGAGGCCGCCATGGCCAGG - Intronic
1076816852 10:132919261-132919283 CCCAGAGGGCGGCCGTGGCCAGG + Intronic
1077093843 11:791126-791148 CCCCCCTTCCCGCCGTGGCCAGG - Exonic
1077383321 11:2257494-2257516 CGCCTCAGGCAGCAGTGGCCCGG + Intergenic
1080503690 11:32892916-32892938 CCTCGCCGCCCGCCGCGGCCCGG + Intergenic
1083212078 11:61194325-61194347 CCCCGGAGGACGCATTGGCCGGG + Intergenic
1083614408 11:64019179-64019201 CACTGCAGGCCGAGGTGGCCCGG + Intronic
1084165368 11:67372816-67372838 TCCCCCGGGCCACCGTGGCCTGG - Intronic
1084520504 11:69659795-69659817 CCCAGGCGGCCGCCGTGGCATGG - Intronic
1084672775 11:70616812-70616834 CCCCGCAGGCTCCCCTCGCCTGG - Intronic
1084889667 11:72230486-72230508 CCCCGCAGTCCCCAGTGGCCTGG - Intronic
1085176574 11:74493439-74493461 CGTCACAGGCCGCGGTGGCCTGG - Exonic
1085527484 11:77172740-77172762 CCCCCCAGGGCGCCGAGACCAGG + Exonic
1085784866 11:79440260-79440282 CCCCGGAGCCCGCCGCGGACTGG - Intronic
1088889276 11:114032004-114032026 CCCAGCAGGCTGCCAGGGCCAGG - Intergenic
1089564701 11:119364394-119364416 CCCCGCGGGCCTGCCTGGCCGGG - Intronic
1089879865 11:121763073-121763095 CGGAGCAGGCCGCCCTGGCCTGG - Intergenic
1091682707 12:2538408-2538430 CCAGGCAGGCTGCTGTGGCCTGG + Intronic
1091740750 12:2959232-2959254 CCCCGCCGCCCGCCCCGGCCCGG + Intergenic
1096515337 12:52152414-52152436 GCCCGCAGGCCAACGTGTCCGGG - Intergenic
1096870385 12:54588766-54588788 CCCCGCGGGCCGCCGAGTCCGGG + Intergenic
1098029053 12:66235419-66235441 CCCCGCCGGCCGCCGCCGCGCGG - Intronic
1102232724 12:111274726-111274748 CCCCGCAGGCGCCCGGAGCCTGG + Intronic
1103944962 12:124520912-124520934 CACCGCAGGCCACAGGGGCCAGG + Intronic
1104841473 12:131828083-131828105 CCCCCCACGGCGCCGAGGCCCGG - Intergenic
1105303160 13:19152771-19152793 CCCCACAGGCCACCTTGGGCAGG + Intergenic
1105303398 13:19153934-19153956 CCCAGGAGGCCACCGGGGCCAGG + Intergenic
1105440965 13:20415232-20415254 CCCTGCAGGCCGCTGTGCCAGGG - Intronic
1107978502 13:45713240-45713262 CGCAGCAGGCCGCCCTGCCCCGG + Exonic
1111951510 13:94712376-94712398 CCCCGCAGGTAGCGGCGGCCGGG + Exonic
1113660582 13:112104394-112104416 CCCCGCTGGGCGCTGCGGCCAGG + Intergenic
1113874425 13:113585219-113585241 CCCCGCGGGCCGCCGTGGGGCGG - Intronic
1113991438 14:16030550-16030572 CCCAGCAGGCCGCCGTGCTGCGG + Intergenic
1114485093 14:23057440-23057462 CCCCGCCCGCCCCCGTCGCCGGG + Exonic
1118604323 14:67491886-67491908 CCAGGCAGGCCCCCGCGGCCTGG - Intronic
1118627807 14:67674874-67674896 CCTCGCCGGCCGGCGGGGCCCGG - Intronic
1118729285 14:68655280-68655302 CTGCTCAGGCTGCCGTGGCCCGG - Intronic
1119492765 14:75051127-75051149 CCTCCCAGGCCCCCGTGCCCTGG - Intronic
1119722011 14:76898104-76898126 CCCCGCCAGCCGCCCTGTCCGGG - Intergenic
1120521847 14:85533772-85533794 CCCCGCAGCGGGCCGGGGCCGGG - Intronic
1121110589 14:91310081-91310103 ACACGGAGGCAGCCGTGGCCCGG - Intronic
1122017117 14:98805659-98805681 CCCCACATGCTGCCCTGGCCTGG + Intergenic
1122058661 14:99122230-99122252 CCCCGCAATCTGCCGTGGGCGGG - Intergenic
1124477069 15:30044658-30044680 CCCCGCTCGCCGCCAGGGCCCGG - Intergenic
1125521337 15:40349342-40349364 CCCAGTAGGCCGCCCTGTCCTGG + Intergenic
1127433395 15:58933636-58933658 CGCCGGCGGCCGCCGAGGCCTGG - Exonic
1127588209 15:60397816-60397838 CCCCGGAGGCCGTCGGGGGCAGG - Intronic
1127913063 15:63434420-63434442 CACCGCAGGCGTCCCTGGCCTGG + Intergenic
1128786021 15:70398024-70398046 CCCAGCAGGCAGCAGCGGCCAGG - Intergenic
1129109225 15:73328033-73328055 CCCCTCATGGAGCCGTGGCCTGG + Intronic
1131215283 15:90530479-90530501 CCCCTCAGGCCGCCCTCGCACGG - Intronic
1132333367 15:101027545-101027567 CCCCTCAGGCCACAGGGGCCGGG + Intronic
1132549084 16:547012-547034 CCTCGCAGGCCTCCTTGCCCAGG - Exonic
1132619286 16:856714-856736 CCCTTCAGGCCGCTGGGGCCTGG - Intronic
1132719815 16:1309993-1310015 CGCCGCAGGCCTTCGGGGCCGGG + Intronic
1132891145 16:2205479-2205501 CTCCGCACTCCGCCGTGTCCAGG - Exonic
1133191064 16:4134005-4134027 CCCAGCAGGGCGCCATGGCCTGG - Intergenic
1136910628 16:34141674-34141696 CCCAGCAGGCCGCCGTGCTGCGG + Intergenic
1141173489 16:81704926-81704948 CCCCGCAGGCCAGCGAAGCCTGG - Intronic
1141550648 16:84804562-84804584 CCCTGTAGGCCGATGTGGCCCGG + Intergenic
1141699299 16:85635123-85635145 CCCCCCAGCCCGCCCTGGTCAGG - Intronic
1142000532 16:87661730-87661752 CCCCGCAGGCCGCCACGGGGCGG + Intronic
1142631595 17:1229436-1229458 TCCCGCAGGCCGCGCTGGCCCGG - Intergenic
1142852704 17:2711833-2711855 CCTCGCGGGCCGCCGTGGGCTGG - Intronic
1142920931 17:3184966-3184988 CCCTGCAGGCTGGTGTGGCCAGG - Intergenic
1142977727 17:3655765-3655787 CCCAGGAGGCCGACGTGGCCAGG - Intronic
1143001266 17:3796688-3796710 CTCAGCAGGCCTCCGTGGCTGGG - Intronic
1143364316 17:6396023-6396045 CCCTGCTGGCCGCCTTGGGCAGG - Intronic
1143488722 17:7270948-7270970 CTCTGCAGGCCTCCGAGGCCTGG - Intergenic
1145163092 17:20589078-20589100 CCCCGCTGGGGGCCGGGGCCGGG + Intergenic
1146057825 17:29589792-29589814 CCACGCTGCCCGCCGGGGCCGGG - Intronic
1147120249 17:38331326-38331348 CCGGGCAGGCTGCCGTGGCCTGG + Exonic
1149470785 17:56913740-56913762 TCCTGCAGGCCGACCTGGCCCGG - Exonic
1149498916 17:57136542-57136564 TTCCTCAGGCCGCCCTGGCCGGG - Intergenic
1149610498 17:57955249-57955271 CCGCGCGGGCCGCAGGGGCCGGG + Exonic
1150416805 17:64994887-64994909 GCCCTCTGGCCTCCGTGGCCGGG - Intergenic
1150794846 17:68228993-68229015 GCCCTCTGGCCTCCGTGGCCAGG + Intergenic
1152237423 17:79145793-79145815 CCCTGCAGGGCACCGTCGCCCGG - Intronic
1152382863 17:79951334-79951356 CCCCGTAAGCCCCCGGGGCCCGG + Intronic
1152538752 17:80964349-80964371 TACAGCAGGCGGCCGTGGCCTGG - Exonic
1152704511 17:81835846-81835868 CCCCGCAGGCATCCTTGGCTGGG + Intergenic
1152706525 17:81846392-81846414 CCCGGGAGGCAGCCCTGGCCCGG + Intronic
1154202307 18:12308127-12308149 CCCCGCTCGACGCCGCGGCCCGG - Exonic
1158870436 18:61681927-61681949 CCCCGCAGGAAGACATGGCCAGG + Intergenic
1160157156 18:76442641-76442663 CCTCGCAGGCCGACGGCGCCAGG - Exonic
1160537728 18:79603969-79603991 CCCCGCAGGCCGTCCCCGCCTGG + Intergenic
1160594306 18:79963731-79963753 CCTCGCTGGGCACCGTGGCCTGG + Intergenic
1161087301 19:2341031-2341053 CTCCGCTGCCCGCCGGGGCCCGG - Exonic
1161514205 19:4687663-4687685 CTCTGCATGCCGCTGTGGCCAGG + Intronic
1162100471 19:8335631-8335653 CCCCGCTGCCCGCCGCGCCCCGG - Exonic
1162291838 19:9786065-9786087 CTCCTCAGGCCTCCGAGGCCGGG - Intronic
1162975780 19:14206494-14206516 CCCTGCAGGCCCCCGCCGCCCGG + Intergenic
1163138691 19:15332079-15332101 CGGCGCAGGCCGCCCCGGCCCGG + Intronic
1163148601 19:15398561-15398583 CGGAGCAGGCCGCCGTGGCAAGG + Intronic
1163155923 19:15439928-15439950 CCCCGCAGGCCAGCGGGGCCAGG + Intronic
1163473569 19:17512020-17512042 CCCCGGCGGCCTCCGTAGCCGGG - Intronic
1163712057 19:18852733-18852755 CACCAGAGGCCTCCGTGGCCAGG - Intronic
1163803971 19:19385317-19385339 CACCGGAGGCGGCCTTGGCCAGG - Intergenic
1165150687 19:33758444-33758466 CACTGCAGGCCGCTCTGGCCTGG - Intronic
1165161794 19:33820707-33820729 CCACGAAGGCCTCCGGGGCCTGG - Intergenic
1165245847 19:34498011-34498033 CCCCGCACTCCTCCCTGGCCTGG + Intronic
1166079341 19:40434029-40434051 CCCGGGAGGCGGCCGCGGCCGGG - Intergenic
1166301956 19:41915943-41915965 CCCCGCCGGCCGGCGTGGTGCGG + Intronic
1166960854 19:46495100-46495122 CCACGCAGGCCGCGGAGGCTGGG - Exonic
1167052276 19:47086524-47086546 CCATGCAGGCAGCCGAGGCCGGG - Exonic
1168233453 19:55047445-55047467 CCCTGCACCCCGGCGTGGCCAGG - Exonic
1202687735 1_KI270712v1_random:61248-61270 CCTCCCAGGCCACCGTGGACTGG - Intergenic
925349809 2:3192983-3193005 CCCGGGAGGCCGCCATGCCCTGG - Intronic
927110178 2:19858932-19858954 CCCGTCAGGCCGCCCAGGCCAGG + Intergenic
927156470 2:20224240-20224262 CCCCCCACGCAGCCCTGGCCCGG + Intronic
928086801 2:28351033-28351055 CCCTGCAGGCCGACGGGCCCTGG - Intergenic
930110706 2:47676260-47676282 CCCCCCATGCTGCCATGGCCAGG - Intergenic
931348742 2:61470559-61470581 TCCCGCAGGCCGCGGCAGCCCGG + Intronic
932790204 2:74648340-74648362 CCCCTCAGGCCGGCGCGGCTGGG + Intergenic
933958619 2:87394337-87394359 CCTCCCAGGCCACCGTGGACTGG + Intergenic
934242748 2:90286343-90286365 CCTCCCAGGCCACCGTGGACTGG + Intergenic
934978683 2:98823123-98823145 CCCCGCAGGCCCGTGTGCCCCGG - Exonic
935396958 2:102619514-102619536 GCCCGCGGGCCGCCCTGGGCAGG + Intergenic
935820146 2:106886399-106886421 TCCCGCAGGCCGCCTGGGACGGG - Exonic
936512114 2:113157196-113157218 CCCCGCACGGCGCCGTCGTCTGG - Intergenic
937288473 2:120767707-120767729 CCACGCAGGCCACTGTGGCTGGG - Intronic
937984425 2:127632192-127632214 CCCCTCAGGGGGCCCTGGCCAGG - Intronic
938005902 2:127788266-127788288 CCCGGCCGGCCGCCCTGTCCGGG - Intronic
938097901 2:128475337-128475359 CCCCTCCAGCTGCCGTGGCCTGG + Intergenic
939731848 2:145794620-145794642 ACCCGCAGGCATCCATGGCCTGG + Intergenic
941020969 2:160407660-160407682 CCCCGCCGGCCGCCGCCGCGCGG - Intronic
941089692 2:161160434-161160456 CCCCTCAGGTCGCCGGCGCCTGG - Exonic
941793200 2:169575110-169575132 CCCCGCCAGCCGCCCTGTCCGGG - Intergenic
942116759 2:172735817-172735839 CCCCGCGGGCTCCCGCGGCCTGG - Intronic
945043705 2:205763789-205763811 CCCCGCGGCCGCCCGTGGCCTGG - Exonic
945431707 2:209772184-209772206 CACCGCGGGCCGCCCTGGGCTGG + Intronic
946235669 2:218323192-218323214 CCCCGCGGGGGGCCGGGGCCGGG + Intronic
946248145 2:218398686-218398708 TCCCGCGGGCCTCCGTGGCGGGG - Intronic
946688664 2:222295055-222295077 TCCCCCAGGCTGCCGTGGCGGGG + Intronic
946865543 2:224038898-224038920 TCCCGCGGGCCGCCTTGGCCGGG - Intronic
947549877 2:231038170-231038192 CCCTGCAAGCCGCCGGAGCCGGG + Exonic
947724189 2:232387337-232387359 GCCCGCAGGCCACCGGGCCCAGG - Intergenic
948116018 2:235494605-235494627 GCCCGCGGGCCGCCGAGCCCGGG - Exonic
948477820 2:238231717-238231739 TCCCAGAGGCCGCCGCGGCCCGG - Intergenic
948560601 2:238848829-238848851 CCCCGCGGGCCGCGGGGGCTTGG + Intronic
948826869 2:240577237-240577259 CCCAGCAGGCTGTGGTGGCCTGG - Intronic
948918859 2:241052175-241052197 CACCCCTGGCCGCCCTGGCCTGG - Intronic
948920909 2:241065486-241065508 CCCTGCCGGCCGCCAGGGCCTGG - Exonic
1171342782 20:24443733-24443755 CCCAGCAGGCAGCCTGGGCCTGG + Intergenic
1171972585 20:31573326-31573348 CCCCTCCGGCGGGCGTGGCCCGG - Intronic
1172015429 20:31870260-31870282 CCGCCCCGGCCGCCGCGGCCCGG - Intronic
1172116571 20:32576730-32576752 CCCAGCAGCCCGCCCAGGCCAGG + Intronic
1172175569 20:32970091-32970113 CCCGGCAGGCCACCATGACCAGG + Intergenic
1172310696 20:33916023-33916045 TCCTGCAGGGCCCCGTGGCCAGG + Intergenic
1172474635 20:35227165-35227187 CGCCGAGGGCCGCCGAGGCCGGG + Intronic
1173649109 20:44651751-44651773 CCCCGCCCGCCGCCGTTCCCGGG + Intronic
1175399652 20:58693094-58693116 CTCCGCGGGCCGCCCGGGCCTGG - Intronic
1176112307 20:63416198-63416220 CCTCGCAGGCCGAGGGGGCCGGG - Intronic
1176430786 21:6574192-6574214 CCGCGCAGCCCACCGGGGCCTGG + Intergenic
1176861739 21:14014799-14014821 CCCCGCTGCCCACAGTGGCCAGG + Intergenic
1178843779 21:36157479-36157501 CCCTGCAGGGCGCAGGGGCCAGG - Intronic
1179163077 21:38913516-38913538 CCCGGCAGGCCGCCAGAGCCAGG - Intergenic
1179706180 21:43181654-43181676 CCGCGCAGCCCACCGGGGCCTGG + Intergenic
1180212285 21:46302095-46302117 CACGGCAGGCAGCCTTGGCCTGG + Exonic
1180315830 22:11276974-11276996 CCCAGCAGGCCGCCGTGCTGCGG - Intergenic
1180339508 22:11606501-11606523 CCCAGCAGGCCGCCGTGTTGCGG + Intergenic
1180699704 22:17774533-17774555 CCCCGCAAGCCGCCGGGGGCGGG - Intronic
1181182878 22:21079594-21079616 CCCCGCAGGCCTCTGTACCCTGG + Intergenic
1181496265 22:23288963-23288985 CCCCCAATGCCACCGTGGCCTGG + Intronic
1181532199 22:23523052-23523074 CCCCGCAGCCTGCCCTGGCTTGG - Intergenic
1182283742 22:29232266-29232288 CCCCCCAGGGAGCCCTGGCCGGG + Exonic
1182301723 22:29340765-29340787 CCCAGCAGGTCGCCCTGGGCGGG + Exonic
1182729432 22:32475136-32475158 CCCCGCGGGCCGCCCAGCCCCGG - Intronic
1183452648 22:37905545-37905567 CCCGGCAGGCCGCAGTGGGGAGG + Intergenic
1184737861 22:46409707-46409729 CCTCCCAGGCCGCCGTGACCGGG + Intronic
1185281509 22:49971894-49971916 CCCCGCAGCCCGCCTGGGACCGG - Intergenic
1185366899 22:50440984-50441006 CCCCGCTGCCCACAGTGGCCAGG + Exonic
1185394176 22:50578352-50578374 CCCCGCGGGCCGCCCTGTGCCGG + Intronic
950082650 3:10234605-10234627 ACAGGCAGGCAGCCGTGGCCAGG - Exonic
952309595 3:32176256-32176278 CCCCGGAGGCTGGCGTGCCCAGG - Intergenic
953926972 3:46987575-46987597 CCCCGCCGCCCGCCATGTCCTGG - Intronic
953959548 3:47256537-47256559 CCCGGCCGGCCGCCCTGTCCGGG + Intronic
954110257 3:48429505-48429527 CCCCGCCCGCCGCCCGGGCCAGG + Intronic
954291679 3:49653207-49653229 GCCCACAGGCCCCCGGGGCCTGG + Exonic
954783976 3:53079954-53079976 CCTCGTGGGCCACCGTGGCCCGG + Intronic
961107862 3:124257655-124257677 CCCCTGAGGCCCCCTTGGCCAGG - Intronic
961657748 3:128452684-128452706 CTCCCCAGGCGGCCGTCGCCAGG - Intergenic
961660944 3:128468576-128468598 CCCTGCAGGCCTGCCTGGCCTGG + Intergenic
962112818 3:132470861-132470883 CCCGGCCGGCCGCCCTGTCCGGG - Intronic
963253597 3:143122243-143122265 CCACGCAGGCCGCCAATGCCTGG + Exonic
963603644 3:147396843-147396865 CCCCGCAGGGCATCGTGCCCCGG - Intronic
966289879 3:178343336-178343358 CCCTGCAAGCAGCCATGGCCAGG - Intergenic
966378870 3:179323474-179323496 CTGCGCAGGACGCCTTGGCCGGG + Intronic
967985990 3:195095676-195095698 GCCTGCAGGCGGCAGTGGCCAGG + Intronic
968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG + Intergenic
968698213 4:2042728-2042750 CCCCGCAGGCCGCCCATGCGTGG + Exonic
968701368 4:2059630-2059652 CCCCGCTGCCCGCCGCGCCCGGG + Exonic
969371233 4:6732837-6732859 CCAGGCAGCCCGCAGTGGCCAGG + Intergenic
975922448 4:79408240-79408262 CCCCCAACACCGCCGTGGCCTGG - Exonic
982291847 4:153789426-153789448 CCCCGCGTGCCGCCGGGGCCCGG + Intergenic
982629918 4:157819398-157819420 CCCTGCAAGCAGGCGTGGCCAGG - Intergenic
985683839 5:1271450-1271472 CCACACAGCCCACCGTGGCCCGG + Intronic
985781113 5:1872342-1872364 CCCCCCCGCCCCCCGTGGCCTGG + Intergenic
986133131 5:4948910-4948932 CCCACCTGGCCGCTGTGGCCTGG - Intergenic
986171033 5:5314834-5314856 CCCCACAGGCCCCTGTGGCTGGG + Intronic
987050472 5:14143773-14143795 CCGCGCTGGCCGCCGCGGCGGGG - Exonic
987085033 5:14460314-14460336 CCCGGTGTGCCGCCGTGGCCTGG + Intronic
992089880 5:73307354-73307376 CCCAGCAGGCCACCGGGCCCAGG + Intergenic
993901195 5:93585052-93585074 ATCCGCAGGACGACGTGGCCGGG + Exonic
998443572 5:142181428-142181450 CCCCGCAAGCAGCCCTGGCAGGG - Intergenic
1001393982 5:171403706-171403728 CCCGGCCGGCCGCCCTGTCCGGG - Intronic
1002417232 5:179126919-179126941 CCCTTAAGGCCGGCGTGGCCAGG + Intronic
1002428776 5:179191286-179191308 CCCCCCAGGGCTCTGTGGCCAGG - Intronic
1002487668 5:179550702-179550724 CTCCGCAGGTCGCCTGGGCCGGG - Exonic
1002700690 5:181122448-181122470 CCCCGCCGGCCCCCGTGCTCCGG + Intergenic
1002926782 6:1609718-1609740 GCGCGCCGGCCGCCCTGGCCCGG - Intergenic
1003893097 6:10580836-10580858 CCCCGCAGGCAGCCCAGCCCTGG + Intronic
1004152541 6:13134221-13134243 CCCCGCCAGCCGCCCTGTCCGGG + Intronic
1004493661 6:16142656-16142678 CCCCTGAGGCCCCTGTGGCCAGG - Intronic
1004562012 6:16760679-16760701 CGCCCCAGGGCGCCGAGGCCGGG + Intronic
1005578468 6:27211602-27211624 GCCCGCAGGGCACTGTGGCCAGG + Intergenic
1007673479 6:43575953-43575975 CCCCGCCGCCCGCCGCGGCCCGG - Exonic
1010513195 6:76744581-76744603 CCCCGCCAGCCGCCCTGTCCGGG + Intergenic
1011734118 6:90295881-90295903 CCCCGCCGGTCGCGGTGGTCCGG + Intronic
1013117705 6:107115194-107115216 CTCCCCGGGCCGCCCTGGCCAGG - Intronic
1013226059 6:108119930-108119952 CCCCAGAGGCCGCCAGGGCCAGG - Intronic
1013428118 6:110033332-110033354 CCCCCCAGGCCTCCCTGACCAGG + Intergenic
1014556787 6:122848693-122848715 CCCGGCCGGCCGCCCTGTCCGGG - Intergenic
1014556890 6:122848922-122848944 CCCGGCCGGCCGCCCTGTCCGGG - Intergenic
1017662428 6:156687454-156687476 CCGCCGAGGCCGCCGCGGCCGGG - Intergenic
1017810676 6:157981660-157981682 CCCCGCAGGCGGGCGTGGAGCGG - Intergenic
1017945620 6:159094362-159094384 CTAGCCAGGCCGCCGTGGCCAGG + Intergenic
1018727807 6:166627184-166627206 CCGCGCCGGCCACCGCGGCCGGG + Intronic
1018769097 6:166956551-166956573 GCCCGCAGGGCGCCCTGGGCTGG - Exonic
1018930870 6:168239533-168239555 GCCTGCAGGCCGCTGAGGCCTGG - Intergenic
1018949872 6:168372144-168372166 CCGCCCAGGACGCCGTGGCCTGG + Intergenic
1019008793 6:168825515-168825537 CCCCGCTGGCCGGCCTGTCCTGG + Intergenic
1019299302 7:295523-295545 CCCAGAAAGCCGCCGTGGCCTGG - Intergenic
1019325930 7:438281-438303 CCCCGCAGCCCGTGCTGGCCAGG + Intergenic
1019611643 7:1939819-1939841 CCCCGAAGGACGGCGAGGCCTGG + Intronic
1019743822 7:2688584-2688606 GCGCGCAGGTCGCCCTGGCCTGG - Intronic
1022099059 7:27158259-27158281 ACCCCCAGGCTTCCGTGGCCCGG - Intergenic
1025793750 7:64718265-64718287 CCCGGCAAGCCGCCCTGTCCGGG + Intergenic
1029025662 7:97414394-97414416 CCTCTCAGGCAGCTGTGGCCTGG + Intergenic
1029367899 7:100127894-100127916 TCGCGCTGGCCCCCGTGGCCCGG - Exonic
1030176602 7:106660830-106660852 CGCCCCGGGCGGCCGTGGCCGGG + Exonic
1032119329 7:129144995-129145017 CCCCGGAGGCGGCCGGCGCCCGG - Exonic
1033324034 7:140362961-140362983 CCCAGCCGGCCGCCCCGGCCGGG + Intronic
1033596736 7:142864442-142864464 CCAGGCAGGCCCCCGTGTCCTGG - Exonic
1049406216 8:142452842-142452864 CCGCGCCGGCCGCCTGGGCCTGG - Intronic
1049507112 8:143008697-143008719 CCCTGCAAGCAGGCGTGGCCAGG + Intergenic
1049587061 8:143437130-143437152 CCCCGCGGGGCCCCTTGGCCTGG - Intergenic
1049597024 8:143489478-143489500 CCCCGCCCACCGCCCTGGCCAGG + Intronic
1049645267 8:143733300-143733322 CCGCCCGGGCCGCCGTGGACTGG - Intronic
1049731877 8:144182315-144182337 CCCTGCTGGACGGCGTGGCCAGG - Intronic
1049759784 8:144326742-144326764 CCCTGCCGGCCGCCGTAGCCCGG + Exonic
1049762655 8:144338096-144338118 CCCCGCAGGCCGCCTTCCCCGGG - Intergenic
1049988430 9:972175-972197 CTCCGCAGGGCGCCTCGGCCTGG + Intergenic
1050618337 9:7426529-7426551 CCCTGCTGGCTGCTGTGGCCTGG + Intergenic
1051659185 9:19409639-19409661 CCCCGCAGGTCCCCGCGGCTGGG + Intronic
1053409140 9:37904261-37904283 GGCCGCAGGCCGCCGCGGCGGGG + Intronic
1055757852 9:79573456-79573478 GCCCGCAGGCCCCCGCGCCCCGG - Intronic
1056755769 9:89381202-89381224 CCACGCAGGTCGCTGTGGGCGGG + Exonic
1057436860 9:95048555-95048577 CCCCTCCGGCCGCGGCGGCCGGG + Intronic
1058005132 9:99906570-99906592 CCCCGCAGGGCCCCCAGGCCGGG - Intergenic
1060811733 9:126614266-126614288 GCCCGCACGACGCCGGGGCCCGG + Intergenic
1060855954 9:126915098-126915120 CCCCGAGGGCCGCCGAAGCCGGG + Intronic
1061262649 9:129488577-129488599 CCCGCCAGGCCGCCGTTTCCCGG + Intergenic
1061307960 9:129743249-129743271 CCTCCGAGGCCGCAGTGGCCAGG + Intronic
1061843746 9:133375680-133375702 CCAGGCAGGGCGCCGAGGCCCGG + Intronic
1062110782 9:134781000-134781022 CCCCGCAGGCCGCCGTGGCCAGG - Intronic
1062162546 9:135088148-135088170 GCCCGCCGGCCGCCTTGGCGCGG + Intronic
1062480142 9:136747323-136747345 GCCCCCAGGCCGCGGTGCCCGGG + Intronic
1062517647 9:136944335-136944357 CCCCTCAGCCCGCCAGGGCCCGG + Intronic
1062568286 9:137172888-137172910 GACCGCAGGCCGGCATGGCCAGG + Intergenic
1062594975 9:137295461-137295483 CCCCGCACTCCGCCCTGCCCCGG - Intergenic
1062633291 9:137477067-137477089 CCCAGAAGGCAGCCCTGGCCTGG + Intronic
1203771922 EBV:53894-53916 CCCTCGAGGCCGCCCTGGCCCGG - Intergenic
1203444962 Un_GL000219v1:45817-45839 CCCAGCAGGCCGCCGTGCTGTGG + Intergenic
1203364124 Un_KI270442v1:242928-242950 CCCAGCAGGCCGCCGTGCTGCGG - Intergenic
1185534115 X:846072-846094 CCTCCCAGGCCACCGTGGACTGG + Intergenic
1185774956 X:2794583-2794605 ACCTGCAGGCGGCCGTGGCCTGG - Exonic
1186244924 X:7608953-7608975 CCCGGCCGGCCGCCCTGTCCGGG - Intergenic
1189002765 X:36963676-36963698 CCCCGCGGGCCGCCGTGGGGCGG + Intergenic
1189391643 X:40581284-40581306 CCTCACGGGCCGCCGGGGCCGGG + Intronic
1190337388 X:49270467-49270489 CCGCGCAGCCCGCCGTGGGCAGG + Exonic
1191034008 X:56005954-56005976 CACTGCAGGCAGGCGTGGCCAGG + Intergenic
1200077222 X:153557162-153557184 CCACGCAGGCCCAAGTGGCCAGG - Intronic
1200217001 X:154372310-154372332 CCCCTCAGCCCAGCGTGGCCAGG + Intronic
1201945094 Y:19502782-19502804 CCGAGCACGCCGTCGTGGCCCGG + Intergenic