ID: 1062111896

View in Genome Browser
Species Human (GRCh38)
Location 9:134786316-134786338
Sequence TCACACACGCCCCCAAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 63}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062111896 Original CRISPR TCACACACGCCCCCAAGGAT GGG (reversed) Intronic
902880776 1:19370466-19370488 TGATACACTCCCCCAGGGATGGG + Intronic
906554429 1:46696964-46696986 TCACACACTCCCTCAACAATTGG + Intronic
918956723 1:191217659-191217681 TCATAGAAGCCACCAAGGATTGG + Intergenic
919776021 1:201194407-201194429 GCACATACCCCCTCAAGGATAGG - Intronic
922192589 1:223332703-223332725 TGACACACGCCCTGAAGGAGAGG - Intronic
1067374956 10:45719331-45719353 TCACGGAAGCCCCCCAGGATCGG - Intergenic
1067882769 10:50060972-50060994 TCACGGAAGCCCCCCAGGATTGG - Intergenic
1067886473 10:50093870-50093892 TCACGGAAGCCCCCCAGGATCGG + Exonic
1075675237 10:124291553-124291575 TCTCCCACGCCCTGAAGGATGGG - Intergenic
1076519709 10:131073867-131073889 GCACACACGCTCCCAAGGAAAGG - Intergenic
1077972868 11:7213605-7213627 TCACACAGGCTCCCAAGAGTGGG + Intergenic
1084276414 11:68053345-68053367 TCACACACGCCCAGCAGGAGGGG + Exonic
1084907309 11:72358032-72358054 TCCCACACTCTCCCAAGGAGAGG + Intronic
1091473783 12:752967-752989 CCACACGCGCCCCCAGCGATGGG - Exonic
1091920812 12:4303211-4303233 TCACACAAGGCCCCAAGGATGGG - Exonic
1104736047 12:131136566-131136588 ACCCACAGGCCCCCAAGGAAGGG + Intronic
1109201340 13:59434986-59435008 TCACACAGGTCGCCAAGGAAGGG + Intergenic
1118627638 14:67674242-67674264 TCAGACACGCCCCCTAGGGCTGG - Intronic
1125832787 15:42728450-42728472 TCACACACGCTCCCAAACCTAGG + Intronic
1126112836 15:45185756-45185778 TCCCAGACACCCCCAAGGAAGGG - Intronic
1128727819 15:70000744-70000766 TAACACACCCCACCAAGCATCGG + Intergenic
1130717996 15:86355380-86355402 TGGCACACACCACCAAGGATTGG + Intronic
1135884863 16:26296465-26296487 ATACACAGGCCCCCAAGGAACGG + Intergenic
1144768616 17:17746541-17746563 TCACTGCCTCCCCCAAGGATGGG + Intronic
1148671255 17:49412025-49412047 TTCCACATGTCCCCAAGGATTGG + Intronic
1151783127 17:76260855-76260877 TCACACACTCCCTGAAGGCTCGG - Intergenic
1152662986 17:81551628-81551650 TGAGACACGCCCCCGAGGTTGGG - Intronic
1153198832 18:2629245-2629267 ACACACATGCTCCAAAGGATTGG + Intergenic
1163650618 19:18515685-18515707 TCACTCACGTCACCAAGGTTCGG + Intronic
1166063455 19:40342121-40342143 TCACACACACCCCAAAAGGTTGG + Intronic
1167762993 19:51461084-51461106 ACACACACACACCCAAGCATTGG - Intergenic
1168726374 19:58584596-58584618 TCCCTCACTCCCCCAAGGAAAGG - Intergenic
926142025 2:10373398-10373420 TCACAGACGCCCGGAAGCATCGG + Intronic
927704644 2:25289657-25289679 TCACAAATGCCCCCAGGGTTTGG + Intronic
929436507 2:41932578-41932600 TCCCTCACGCAGCCAAGGATGGG - Intergenic
937644513 2:124251286-124251308 TCCCCCACCCCCCCAAGTATTGG + Intronic
938822613 2:134975107-134975129 TCACCCAGGGGCCCAAGGATGGG - Intronic
941583836 2:167332047-167332069 TCTCACAAGCCCCCAAGTCTAGG - Intergenic
943524192 2:188996239-188996261 ACACACACACACTCAAGGATAGG - Intronic
948908295 2:240990306-240990328 GCACACACACGCCCAAGGCTTGG - Intronic
1176049278 20:63108063-63108085 TCACCCCCGCCCCCAATGGTGGG + Intergenic
1176213174 20:63935448-63935470 TGACACACAGCCCCCAGGATGGG - Exonic
1182116664 22:27760615-27760637 ACACCCACAACCCCAAGGATGGG + Intronic
1182863780 22:33584363-33584385 TCACAGTGGCCCCCAAGGCTCGG + Intronic
1185056583 22:48582000-48582022 TCACACACGCACCCAGTGAGTGG + Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
953774315 3:45802470-45802492 TCCCACAAGCCCCCAAGGAATGG + Intergenic
962894021 3:139697961-139697983 TCACACCCCACCCCAAGGCTTGG - Intergenic
971024085 4:22571058-22571080 TCACACATGCCCCCAAGCCTGGG - Intergenic
977870061 4:102080750-102080772 TCACACCCACACCCAAGGAGGGG + Intergenic
981454681 4:144939594-144939616 CCACATAGGCTCCCAAGGATGGG - Intergenic
982819477 4:159928029-159928051 TCACACAAGCCCGCAGGGAAAGG - Intergenic
983622430 4:169774928-169774950 TCCCACGCGCCCCCTAGGGTGGG + Intergenic
985298953 4:188466981-188467003 CCACACACGTCCCCAAGTAAAGG - Intergenic
985475871 5:78694-78716 TCACACAAAGCCCCAAGCATTGG - Intergenic
987424441 5:17756639-17756661 CCACACACATCCCCAAGGAAGGG - Intergenic
988212090 5:28216842-28216864 TCACTCTTGTCCCCAAGGATGGG - Intergenic
992366829 5:76100941-76100963 TTCCACACGTCCCCAAGGCTGGG + Intronic
1001766454 5:174251476-174251498 TCACACAGGCCCCCAGGGAAGGG + Intergenic
1003091354 6:3106249-3106271 TCACAGATGCCCGCAAGCATCGG + Intronic
1022248176 7:28581530-28581552 TCACAAACGCCCTCAAGTATGGG + Intronic
1030224461 7:107133655-107133677 TCACACAGGGACCCAAGGAGGGG + Intronic
1037157586 8:15723630-15723652 TCAAAGAAGGCCCCAAGGATAGG + Intronic
1037693907 8:21207412-21207434 TCACTAATGCCCCCAAGGAAGGG + Intergenic
1038033199 8:23662631-23662653 CCTCACGGGCCCCCAAGGATTGG - Intergenic
1046216257 8:111151867-111151889 TCACACTAGCCCCCAAGCAATGG - Intergenic
1047499340 8:125430014-125430036 GCGCACACGCCCCCAGGGCTGGG - Intergenic
1048450338 8:134527862-134527884 TCACATACGCCCCCAAATCTTGG + Intronic
1062111896 9:134786316-134786338 TCACACACGCCCCCAAGGATGGG - Intronic
1195285174 X:103376736-103376758 ACACAGAGGCCCCCAGGGATGGG + Intronic