ID: 1062113720

View in Genome Browser
Species Human (GRCh38)
Location 9:134796572-134796594
Sequence TACGGAAGAGTTCACTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 82}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062113720_1062113730 11 Left 1062113720 9:134796572-134796594 CCCTGGGAGTGAACTCTTCCGTA 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1062113730 9:134796606-134796628 TCGACCGCAGCCCTGGTCTTGGG 0: 1
1: 0
2: 2
3: 2
4: 57
1062113720_1062113731 12 Left 1062113720 9:134796572-134796594 CCCTGGGAGTGAACTCTTCCGTA 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1062113731 9:134796607-134796629 CGACCGCAGCCCTGGTCTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 86
1062113720_1062113729 10 Left 1062113720 9:134796572-134796594 CCCTGGGAGTGAACTCTTCCGTA 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1062113729 9:134796605-134796627 CTCGACCGCAGCCCTGGTCTTGG 0: 1
1: 0
2: 0
3: 4
4: 98
1062113720_1062113734 18 Left 1062113720 9:134796572-134796594 CCCTGGGAGTGAACTCTTCCGTA 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1062113734 9:134796613-134796635 CAGCCCTGGTCTTGGGGTTTGGG 0: 1
1: 0
2: 4
3: 24
4: 279
1062113720_1062113737 23 Left 1062113720 9:134796572-134796594 CCCTGGGAGTGAACTCTTCCGTA 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1062113737 9:134796618-134796640 CTGGTCTTGGGGTTTGGGAGTGG 0: 1
1: 1
2: 2
3: 47
4: 412
1062113720_1062113733 17 Left 1062113720 9:134796572-134796594 CCCTGGGAGTGAACTCTTCCGTA 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1062113733 9:134796612-134796634 GCAGCCCTGGTCTTGGGGTTTGG 0: 1
1: 0
2: 1
3: 36
4: 312
1062113720_1062113727 4 Left 1062113720 9:134796572-134796594 CCCTGGGAGTGAACTCTTCCGTA 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1062113727 9:134796599-134796621 AGGGGCCTCGACCGCAGCCCTGG 0: 1
1: 0
2: 1
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062113720 Original CRISPR TACGGAAGAGTTCACTCCCA GGG (reversed) Intronic